View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16310_low_7 (Length: 217)
Name: NF16310_low_7
Description: NF16310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16310_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 15808173 - 15808356
Alignment:
| Q |
19 |
ctatacgcactgcaacttgatcttgagtggccatgaagtaagagatatgaaatcagctaatatatgttttttataatttgtagtcaacagaatcatcaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15808173 |
ctatacgcactgcaacttgatcttgagtggccatgaagtaagagatatgaaatcagctaatatatgttttttataatttgtagtcaacagaatcatcaac |
15808272 |
T |
|
| Q |
119 |
tgatatatttgcatcaatttctttgttacaaaaatgcagatatttttggaagaatttaataccagaagttttgctcgtcctatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15808273 |
tgatatatttgcatcaatttctttgttacaaaaatgcagatatttttgtaagaatttaataccagaagttttgctcgtcctatg |
15808356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University