View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16311_low_6 (Length: 355)
Name: NF16311_low_6
Description: NF16311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16311_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 169 - 331
Target Start/End: Original strand, 40114373 - 40114535
Alignment:
| Q |
169 |
ggtgggttaagaggtaggatgatgtgtggtggatgtgggttgatgcttggtattggtttgtagataggtgtcggttgtattaaggatgggtagggaaaat |
268 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40114373 |
ggtggtttaagaggtaggatgatgtgtggtggatgtgggttgatgcttggtattggtttgtagataggtgtcagttgtattaaggatgggtagggaaaat |
40114472 |
T |
|
| Q |
269 |
ggttgtcatagaagaccacatgacgggatgtgtatattttgtttgttatgggatccaggcagc |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40114473 |
ggttgtcatagaagaccacatgacgggatgtgtatattttgtttgttatgggatccaggcagc |
40114535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 2 - 131
Target Start/End: Original strand, 40114248 - 40114377
Alignment:
| Q |
2 |
aagtagaagatgtagtgggcagattattacctgatgaagaacttgagtgcaaggttgcctcttgaggatttgcaacagatgtagaggtagtggtggtcgc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40114248 |
aagtagaagatgtagtgggcagattattacctgatgaagaacttgagtgcaaggttgcctcttgaggatttgcaacagatgtagaggtagtggtggtcac |
40114347 |
T |
|
| Q |
102 |
agtttgtgaagtattagttgtaagtggtgg |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40114348 |
agtttgtgaagtattagttgtaagtggtgg |
40114377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University