View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16311_low_9 (Length: 240)
Name: NF16311_low_9
Description: NF16311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16311_low_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 21 - 240
Target Start/End: Original strand, 30553008 - 30553227
Alignment:
| Q |
21 |
caccgccaccaccaccaccactcgtaagaggattcctgattccgcttccgattcaaagatccagttcacactcgaacacgctttcggcgattccgatttc |
120 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30553008 |
caccaccaccaccaccaccactcgtaagaggattcctgattccgcttccgattcaaagatccagttcacactcgaacacgctttcggtgattccgatttc |
30553107 |
T |
 |
| Q |
121 |
tctgaagctggtaacttctctgctcgtctcaaaacttggagtcacggcgctcaggttcgtcaatttctttttaattgttgatatttttcaaagctagtat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30553108 |
tctgaagctggtaacttctctgctcgtctcaaaacttggagtcacggcgctcaggttcgtcaatttctttttaattgttgatatttttcaaagctagtat |
30553207 |
T |
 |
| Q |
221 |
aataattcgttgattggttc |
240 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30553208 |
aataattcgttgattggttc |
30553227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University