View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16312_high_2 (Length: 237)

Name: NF16312_high_2
Description: NF16312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16312_high_2
NF16312_high_2
[»] chr1 (2 HSPs)
chr1 (1-218)||(12531419-12531636)
chr1 (52-208)||(12533537-12533693)


Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 12531419 - 12531636
Alignment:
1 aggaagtgtgctgagatggctggaatggctgtacagattgttgtgtcagctgttttgggagatccaacggttcttattgctgggattatggggtcgttga 100  Q
    |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12531419 aggaagtgtgctgagatggctggaatggctgtacagatcgttgtctcagctgttttgggagatccaacggttcttattgctgggattatggggtcgttga 12531518  T
101 tatcgcgatcttgatcttgtggtggatggtagttcattgtattgtatcaaatatctgctactgtgaaaaatgtaagtggaatatttgtgtatcaatttca 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||    
12531519 tatcgcgatcttgatcttgtggtggatggtagttcattgtattgtatcaaatatctgctattgtgaaaaatgtcagtggaatatttgtgtatcaatttca 12531618  T
201 atgaatatatattcatat 218  Q
    ||||||||||||||||||    
12531619 atgaatatatattcatat 12531636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 52 - 208
Target Start/End: Original strand, 12533537 - 12533693
Alignment:
52 gttttgggagatccaacggttcttattgctgggattatggggtcgttgatatcgcgatcttgatcttgtggtggatggtagttcattgtattgtatcaaa 151  Q
    ||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||| |||||||||||||| ||||||||||||||||||||||||| |    
12533537 gttttgggagagccaacggttcttattgctgggattatggggtcattgatgtcacgagcttgatcttgtggtcgatggtagttcattgtattgtatcaga 12533636  T
152 tatctgctactgtgaaaaatgtaagtggaatatttgtgtatcaatttcaatgaatat 208  Q
    | | ||||| ||||| ||||||||||| ||||||||||||| ||||| |||| ||||    
12533637 tgtatgctattgtgataaatgtaagtgaaatatttgtgtattaatttgaatgtatat 12533693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University