View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16313_high_2 (Length: 291)
Name: NF16313_high_2
Description: NF16313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16313_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 120 - 281
Target Start/End: Complemental strand, 16779125 - 16778963
Alignment:
| Q |
120 |
aaaaattcatgcaggaaggaagcagaaacagcacaacattgcatctgacacaaggcacatgatggg-taggtttagctgcggaacatgtggtcgctccaa |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | | |
|
|
| T |
16779125 |
aaaaagtcatgcaggaaggaagcagaaacagcacaacattgcatctgacacaaggcacatgatggggtaggtttagctgcggaacatgtggtcgcttcca |
16779026 |
T |
 |
| Q |
219 |
caatagtggtgaatttgttttgtcttttcctgatctgcatgtttctcattccatttgcctttg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16779025 |
caatagtggtgaatttgttttgtcttttcctgatctgcatgtctctcattccatttgcctttg |
16778963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University