View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16314_high_2 (Length: 302)
Name: NF16314_high_2
Description: NF16314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16314_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 136 - 260
Target Start/End: Original strand, 25632690 - 25632814
Alignment:
| Q |
136 |
agattttatgtaggttgtttttgtatcctgaagagttcaccaagataggctaaaaacaacttatagaaatgatataggctatttccgtaagcactgtcaa |
235 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25632690 |
agattttatgtaggttgttttggtatcctgaagagttcaccaagataggctaaaaacaacttatagaaatgacataggctatttccgtaagcactgtcaa |
25632789 |
T |
|
| Q |
236 |
acaatcttgcaagtgtttatgtgag |
260 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
25632790 |
acaatctcgcaagtgtttatgtgag |
25632814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 4 - 86
Target Start/End: Original strand, 25632548 - 25632631
Alignment:
| Q |
4 |
aaaaaacaacagctattacgtaattggtccatgtcagagagaatcgacaaaa-tttgtcgaggcctaacacaaccctcacattt |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
25632548 |
aaaaaacaacagctattacgtaattggtccatgtcagagagaatcgacaaaattttgtcgaggcctaacacaaccttcacattt |
25632631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 14 - 86
Target Start/End: Complemental strand, 15117886 - 15117813
Alignment:
| Q |
14 |
agctattacgtaattggtccatgtcagagagaatcgacaaaa-tttgtcgaggcctaacacaaccctcacattt |
86 |
Q |
| |
|
|||||||| | ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15117886 |
agctattaggcaattggtccatgtcaaagagaatcgacaaaattttgtcgaggcctaacacaaccctcacattt |
15117813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University