View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16315_low_5 (Length: 237)

Name: NF16315_low_5
Description: NF16315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16315_low_5
NF16315_low_5
[»] chr2 (1 HSPs)
chr2 (1-34)||(17196414-17196447)


Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 17196447 - 17196414
Alignment:
1 cctcgtttggccttctctctcttgccggttaggg 34  Q
    ||||||||||||||||||||||||||||||||||    
17196447 cctcgtttggccttctctctcttgccggttaggg 17196414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University