View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16317_high_17 (Length: 313)
Name: NF16317_high_17
Description: NF16317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16317_high_17 |
 |  |
|
| [»] scaffold0728 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0728 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold0728
Description:
Target: scaffold0728; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 27 - 284
Target Start/End: Original strand, 5389 - 5646
Alignment:
| Q |
27 |
tcaacatatgttatcgccttcaaatactaatatgctgtctcccaagaatgaagagcatcgtcttttacaagcttcatttggtgtcccttcatgcggtagt |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5389 |
tcaacatatgttatcgccttcaaatattaatatgctgtctcccaagaatgatgagcatcgtcttttacaagcttcatttagtgtcccttcatgcggtagc |
5488 |
T |
 |
| Q |
127 |
atgtcaccaagaaggcttgaaccaatctccccactgatccctcaaatgtccacatttcctcatcgcgagaaacagcagcaacagctgcagagtgttagtt |
226 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||| |||||||||||| || |||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
5489 |
atgtcacctagaaggcttgaacaaatctccccactgagccctcaaatgtctgcacttcctcatcgcgagaaacagcagcaacaactgcagagtgttagct |
5588 |
T |
 |
| Q |
227 |
ctggggaacttggttccaaaatcccttccccagttgttggatcacctacggacccatg |
284 |
Q |
| |
|
|| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5589 |
ctagggaacttggttacaaaatcccttcctcagttgttggatcacctacggacccatg |
5646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 27 - 284
Target Start/End: Original strand, 19409823 - 19410080
Alignment:
| Q |
27 |
tcaacatatgttatcgccttcaaatactaatatgctgtctcccaagaatgaagagcatcgtcttttacaagcttcatttggtgtcccttcatgcggtagt |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19409823 |
tcaacatatgttatcgccttcaaatattaatatgctgtctcccaagaatgatgagcatcgtcttttacaagcttcatttagtgtcccttcatgcggtagc |
19409922 |
T |
 |
| Q |
127 |
atgtcaccaagaaggcttgaaccaatctccccactgatccctcaaatgtccacatttcctcatcgcgagaaacagcagcaacagctgcagagtgttagtt |
226 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||| |||||||||||| || |||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
19409923 |
atgtcacctagaaggcttgaacaaatctccccactgagccctcaaatgtctgcacttcctcatcgcgagaaacagcagcaacaactgcagagtgttagct |
19410022 |
T |
 |
| Q |
227 |
ctggggaacttggttccaaaatcccttccccagttgttggatcacctacggacccatg |
284 |
Q |
| |
|
|| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19410023 |
ctagggaacttggttacaaaatcccttcctcagttgttggatcacctacggacccatg |
19410080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University