View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16317_high_8 (Length: 345)
Name: NF16317_high_8
Description: NF16317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16317_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 42445692 - 42445377
Alignment:
| Q |
1 |
gctgagagactgaaaccattgagttcatcattcatgagaatcatggcggcaccacctgctctttgtacttcctgtcctttggcaattcttcctatacccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445692 |
gctgagagactgaaaccattgagttcatcattcatgagaatcatggcggcaccacctgctctttgtacttcctgtcctttggcaattcttcctatacccc |
42445593 |
T |
|
| Q |
101 |
ctcccctctcacacaaaacaacctttcctctgaagtcaatgtcactcaaggatccattagcacaaaatgaagattctactttgccatttattcctgcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445592 |
ctcccctctcacacaaaacaacctttcctctgaagtcaatgtcactcaaggatccattagcacaaaatgaagattctactttgccatttattcctgcata |
42445493 |
T |
|
| Q |
201 |
tgctaagggcaacagtgttggagagaaatcggaaggctggaaaacagattcgccctcaaattcttccccatttccaagcactgctgttgccacaatggtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445492 |
tgctaagggcaacagtgttggagagaaatcggaaggctggaaaacagattcgccctcaaattcttccccatttccaagcactgctgttgccacaatggtt |
42445393 |
T |
|
| Q |
301 |
ctgtcaatagtgcttg |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42445392 |
ctgtcaatagtgcttg |
42445377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University