View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16321_low_1 (Length: 368)
Name: NF16321_low_1
Description: NF16321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16321_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 11 - 349
Target Start/End: Original strand, 54774891 - 54775229
Alignment:
| Q |
11 |
agaatatccagtcttaactgcaacagaatgagcttgttttccggctactacgtcagaaagattagaagcagccaagaaaacaccggcgagtgtatgggca |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54774891 |
agaacatccagtcttaactgcaacagaatgagcttgttttccggctactacgtcagaaagattagaagcagccgagaaaacaccggcgagtgtatgggca |
54774990 |
T |
 |
| Q |
111 |
ttagggatcacattattggcacgcatcatacgacgaaagaggcttatagcgaaggaagaagatgaagaggaatggttttgagagaaagcgttgatgagag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774991 |
ttagggatcacattattggcacgcatcatacgacgaaagaggcttatagcgaaggaagaagatgaagaggaatggttttgagagaaagcgttgatgagag |
54775090 |
T |
 |
| Q |
211 |
agttccatgaaacgtcgtctttgtcgttgtcgtttatagaatcaaagagggttaaagcgtgtgataagtgattggttttggcgtagagattgaggaaagt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54775091 |
agttccatgaaacgtcgtctttgtcgttgtcgtttatagaatcaaagagggttaaagcgtgtgataagtgattggttttggcgtagagattgaggaaagt |
54775190 |
T |
 |
| Q |
311 |
gttggtgacgtaaatggaagagatggaaccagtttttag |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54775191 |
gttggtgacgtaaatggaagagatggaaccagtttttag |
54775229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University