View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16323_high_1 (Length: 276)
Name: NF16323_high_1
Description: NF16323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16323_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 3 - 266
Target Start/End: Original strand, 4822100 - 4822363
Alignment:
| Q |
3 |
atggacatcatcagaactagcagcttcgtagagacaactttccggtgaaccactatcctcgtgaccgggtggcttggccttccgacgaccagctccaacc |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4822100 |
atggccatcatcagaactagcagcttcgtagagacaactttccggtgaaccactatcctcgtgaccgggtggcttggccttccgacgaccagctccaacc |
4822199 |
T |
|
| Q |
103 |
ggaacgttacgcagggccccaccagccgtccagtacctttgacaactcttacaaaaatgtcttggttgattaacgttgtaattattgaaataacaaaatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4822200 |
ggaacgttacgcagggccccaccagccgtccagtacctttgacaactcttacaaaaatgtcttggttgattaacgttgtaattattgaaataacaaaatt |
4822299 |
T |
|
| Q |
203 |
tagtttccatactcttgcatcttggacatggtatgatcttttctatcttcttctccaccctttg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4822300 |
tagtttccatactcttgcatcttggacatggtatgatcttttctatcttcttctccaccgtttg |
4822363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 142 - 231
Target Start/End: Original strand, 9431348 - 9431437
Alignment:
| Q |
142 |
tgacaactcttacaaaaatgtcttggttgattaacgttgtaattattgaaataacaaaatttagtttccatactcttgcatcttggacat |
231 |
Q |
| |
|
||||||||| ||||||||| | |||||||| || ||||| || ||||||||||||||||| || || | ||| ||||||||||||||| |
|
|
| T |
9431348 |
tgacaactccgacaaaaatgccgaggttgattgacattgtagttgttgaaataacaaaattttgtgtcgaaacttttgcatcttggacat |
9431437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 176 - 233
Target Start/End: Complemental strand, 18188194 - 18188137
Alignment:
| Q |
176 |
cgttgtaattattgaaataacaaaatttagtttccatactcttgcatcttggacatgg |
233 |
Q |
| |
|
|||||||||||||| | ||||||||||| || ||||| || ||||||||||||||||| |
|
|
| T |
18188194 |
cgttgtaattattgtagtaacaaaattttgtgtccatgcttttgcatcttggacatgg |
18188137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University