View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16325_high_1 (Length: 464)
Name: NF16325_high_1
Description: NF16325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16325_high_1 |
 | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0082 (Bit Score: 162; Significance: 3e-86; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 26 - 195
Target Start/End: Complemental strand, 28803 - 28634
Alignment:
| Q |
26 |
gcacttcccggcgaacgaattgaatgaatcatcatgaaaattaattaaacacgtccgttacttaaataccagtaggctgtaaaagcagctccccctgaaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28803 |
gcacttcccggcgaacgaattgaatgaatcatcatgaaaattaattaaacacgtccgttacttaaataccagtaggctgtaaaagcagctccccctgaaa |
28704 |
T |
|
| Q |
126 |
gccgtatggatcctttcgctcgatcggcaggctctcctccctacagagttgcttctgttagaagagaaga |
195 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28703 |
gccgtatggatcccttcgctcgatcggcaggctctcctccctacagagttgcttctgttcgaagagaaga |
28634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 130; Significance: 3e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 195 - 391
Target Start/End: Complemental strand, 6101620 - 6101423
Alignment:
| Q |
195 |
attatattataaaacagttgctgcgaaaaaagcgcaaaccaaaagttcatgattggctagaagaactacaagaattgagagagaccgcggatggtctgaa |
294 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||| | |||||||||| |
|
|
| T |
6101620 |
attatattataaaacaactgcagggaaaaaagcgcaaaccaaaagtttatgattagctagaagaactacaagaattgagagaaaccacatatggtctgaa |
6101521 |
T |
|
| Q |
295 |
tacctcgatgacagttatgacataagt-aattgtcaaacaaatgaaacgacataaggaagatatacctctcattttatcgaccgaattggttggggaa |
391 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||| ||||| |
|
|
| T |
6101520 |
tacctcaatgacagttatgacataagtgaattgtcaaacaaatgaaatgacataaggaagatataactctcactttatcgaccgaattggttagggaa |
6101423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University