View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16328_low_5 (Length: 287)

Name: NF16328_low_5
Description: NF16328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16328_low_5
NF16328_low_5
[»] chr6 (1 HSPs)
chr6 (74-193)||(1977562-1977681)


Alignment Details
Target: chr6 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 74 - 193
Target Start/End: Complemental strand, 1977681 - 1977562
Alignment:
74 gttttgtgcaaatctagtctcacagacaacctcttgcagatgagttttgtttttcctgtgttgatatctaactgaaacaacaggtgtgataatatgcagg 173  Q
    |||||||||||||||  ||||||||| |  ||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||| ||    
1977681 gttttgtgcaaatctgatctcacagatagtctcttgcagatgagttttgtttttcctgtgtagatatctaactgaaacagcaggcgtgataatatgccgg 1977582  T
174 cctagaatcagagaaattgg 193  Q
    ||||||||||||||||||||    
1977581 cctagaatcagagaaattgg 1977562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University