View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1632_high_62 (Length: 227)
Name: NF1632_high_62
Description: NF1632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1632_high_62 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 14041550 - 14041627
Alignment:
| Q |
1 |
ataaatatttctctccatgacgacgatgatgatcatataataatgaaatttataacgagggtaatcttcaaagaatggttgtt |
83 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14041550 |
ataaatatttttctcaatgacgacgatgatgat-----aataattgaatttataacgagggtaatcttcaaagaatggttgtt |
14041627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University