View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1632_high_64 (Length: 219)
Name: NF1632_high_64
Description: NF1632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1632_high_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 2 - 210
Target Start/End: Complemental strand, 37769512 - 37769304
Alignment:
| Q |
2 |
ctcctataaatgtgtatatatagtccttcaatctcaaaagcttattgcagtctgatcttgaagatgggaagcatgtcgaattcgttgaaaccagccttgc |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37769512 |
ctcccataaatgtgtatatatagtccttcaatctcaaaagcttattgcagcctgatcttgaagatgggaagcatgtcgaattcattgaaaccagccttgc |
37769413 |
T |
|
| Q |
102 |
taatggttgcggtgcagatggtattttctgcttgcaatatcatctacaagcttgccatttatgatggaatgagtatcatagtcattgcagcctatcgtct |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37769412 |
taatggttggggtgcagatggtattttctgcttgcaatattatctacaagcttgccatttatgatggaatgaatatcatagtcattgcagcctatcgtct |
37769313 |
T |
|
| Q |
202 |
cgcctttgc |
210 |
Q |
| |
|
||||||||| |
|
|
| T |
37769312 |
cgcctttgc |
37769304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University