View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1632_high_65 (Length: 215)
Name: NF1632_high_65
Description: NF1632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1632_high_65 |
 |  |
|
| [»] chr3 (169 HSPs) |
 |  |
|
| [»] chr5 (137 HSPs) |
 |  |
|
| [»] chr4 (171 HSPs) |
 |  |
|
| [»] chr7 (146 HSPs) |
 |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |
|
| [»] chr8 (145 HSPs) |
 |  |
|
| [»] chr6 (116 HSPs) |
 |  |
|
| [»] chr1 (169 HSPs) |
 |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0811 (1 HSPs) |
 |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |
|
| [»] scaffold0347 (1 HSPs) |
 |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |
|
| [»] scaffold0106 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |
|
| [»] scaffold0176 (2 HSPs) |
 |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 145)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 75 - 203
Target Start/End: Complemental strand, 31909574 - 31909446
Alignment:
| Q |
75 |
taagaaagtattactgtttgattgataaagagctaactatgaaacgctatttagataaaagcattgcatcaatcatgcaatagattgttaaatataggct |
174 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
31909574 |
taagaaagtattagtgtttgattgataaagagctaactatgaaacgctatttagataaaagcattgcagcaatcatgcaatagattgttaaatgtaggct |
31909475 |
T |
 |
| Q |
175 |
aaaatatggttttggttcctgcaaatatg |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
31909474 |
aaaatatggttttggtccctgcaaatatg |
31909446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 31909933 - 31909858
Alignment:
| Q |
1 |
tagtatgataataataatgataattattgttgttgtgaattgttgtgtatttatatcatagcaaagtaaacaaata |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31909933 |
tagtatgataataataatgataattattgttgttgcgaattgttgtgtatttatatcatagtaaagtaaacaaata |
31909858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 17302144 - 17302099
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17302144 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
17302099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 44559058 - 44559106
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44559058 |
tataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
44559106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 41451834 - 41451881
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41451834 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
41451881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 13215058 - 13215104
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13215058 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
13215104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 20131315 - 20131361
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20131315 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
20131361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 2481184 - 2481237
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| ||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
2481184 |
ttaaataaaggctaaaatatggttttggtacttgcaaatatgtctcgttttggt |
2481237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 4424186 - 4424141
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4424186 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
4424141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 25705084 - 25705129
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25705084 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
25705129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 31644840 - 31644885
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31644840 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
31644885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 33576118 - 33576073
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33576118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
33576073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 42695868 - 42695912
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
42695912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 4842865 - 4842908
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggt |
4842908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 10671944 - 10671897
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
10671944 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
10671897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 11788419 - 11788372
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
11788419 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
11788372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 16523328 - 16523281
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16523328 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
16523281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 20939324 - 20939281
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
20939281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 10671628 - 10671674
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10671628 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggt |
10671674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 13215367 - 13215321
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
13215367 |
taggctaaaatatgggtttggtccctgcaaatatgtctcgttttggt |
13215321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 24358614 - 24358660
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24358614 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
24358660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 25705451 - 25705405
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25705451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
25705405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 26709694 - 26709740
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
26709694 |
taggctaaaatatgattttagttcctgcaaatatgtctcgttttggt |
26709740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 33575750 - 33575796
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
33575750 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggt |
33575796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 38639410 - 38639456
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
38639410 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
38639456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 43597152 - 43597198
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
43597152 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggt |
43597198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 44559407 - 44559365
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
44559365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 2481558 - 2481513
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2481558 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
2481513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 4423894 - 4423939
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4423894 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
4423939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 14003743 - 14003698
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
14003743 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
14003698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 15842824 - 15842779
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15842824 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
15842779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 16522990 - 16523035
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16522990 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
16523035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 16673410 - 16673455
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
16673410 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
16673455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 19183781 - 19183826
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
19183781 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
19183826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 29859873 - 29859828
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29859873 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
29859828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 30215876 - 30215827
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
30215876 |
atataggctaaaatatggttttggtccctgcaaatatatcgcgttttggt |
30215827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 34964159 - 34964118
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgtttt |
34964118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 36815836 - 36815791
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
36815836 |
aggctaaaatatggttttggtccatgcaaatatgtctcgttttggt |
36815791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 37228732 - 37228777
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
37228732 |
aggctaaaatatggttttggtccctgcaaatatgtatcgttttggt |
37228777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 40302344 - 40302295
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
40302344 |
atataggctaaaatatggttttagtccctgcaaatatggctcgttttggt |
40302295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 43788849 - 43788902
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| |||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
43788849 |
ttaaaaataggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
43788902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 146690 - 146646
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggt |
146646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 3832641 - 3832593
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
3832641 |
tataggttaaaatatggttttggtccctgcaaatatgtttcgttttggt |
3832593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 4042890 - 4042846
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggt |
4042846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 4794130 - 4794174
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggt |
4794174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 5334751 - 5334795
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
5334795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 5335040 - 5334996
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
5334996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 5790899 - 5790855
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
5790855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 9195054 - 9195098
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
9195098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 10375069 - 10375025
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
10375025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 10664982 - 10665026
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
10664982 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
10665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 11713485 - 11713529
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
11713529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 20131681 - 20131637
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
20131637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 26239162 - 26239118
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
26239162 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
26239118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 26813866 - 26813910
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
26813910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 36622250 - 36622294
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
36622294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 215
Target Start/End: Complemental strand, 36806892 - 36806852
Alignment:
| Q |
175 |
aaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggt |
36806852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 37271731 - 37271783
Alignment:
| Q |
163 |
taaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| |||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
37271731 |
taaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
37271783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 1138361 - 1138318
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
1138361 |
taggctaaaatatggttttgatccctgcaaatatgtctcgtttt |
1138318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 16673773 - 16673730
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
16673773 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
16673730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 32691310 - 32691357
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
32691310 |
ataggctaaaatatggttttagtttctgcaaatatgcctcgttttggt |
32691357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 38980260 - 38980209
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| |||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
38980260 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
38980209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 41693667 - 41693718
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| |||||||||||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
41693667 |
aaataaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggt |
41693718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 44985991 - 44985940
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
44985991 |
aaatttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggt |
44985940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 146328 - 146370
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
146370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 1137983 - 1138025
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
1138025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 14003407 - 14003453
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
14003407 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
14003453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 15842459 - 15842505
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15842459 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttggt |
15842505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 27310870 - 27310920
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
27310870 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
27310920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 1295544 - 1295503
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggt |
1295503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 4042609 - 4042654
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
4042609 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
4042654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 10374769 - 10374818
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| |||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
10374769 |
atatatgctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
10374818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 13850881 - 13850840
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggt |
13850840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 16900207 - 16900162
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
16900207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
16900162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 16993598 - 16993553
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
16993598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
16993553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 17541373 - 17541426
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| |||||||||||||||||| || || ||||||||| ||||||||||| |
|
|
| T |
17541373 |
ttaaataaaggctaaaatatggttttagtccccgcaaatatgcctcgttttggt |
17541426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 17541777 - 17541732
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
17541777 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggt |
17541732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 17912808 - 17912767
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggt |
17912767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 18113088 - 18113133
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
18113088 |
aggctaaaatatggttttggtccctgcaaatatgcctagttttggt |
18113133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 19184152 - 19184107
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
19184152 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
19184107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 22881612 - 22881657
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
22881612 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
22881657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 23732329 - 23732284
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23732329 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggt |
23732284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 24358946 - 24358901
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
24358946 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
24358901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 24483892 - 24483847
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
24483892 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
24483847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 26814230 - 26814185
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
26814230 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
26814185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 29831813 - 29831858
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
29831813 |
aggctaaaatatagttttgatccctgcaaatatgtctcgttttggt |
29831858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 29859490 - 29859531
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggt |
29859531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 30215421 - 30215466
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
30215421 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
30215466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 33732861 - 33732906
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
33732861 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
33732906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 37272103 - 37272058
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
37272103 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
37272058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 37911121 - 37911076
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
37911121 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
37911076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 43672327 - 43672274
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| ||||||||||||| ||||||| ||||||||||||| | |||||||| |
|
|
| T |
43672327 |
ttaaataaaggctaaaatatgattttggtccctgcaaatatgttttgttttggt |
43672274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 43789193 - 43789148
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
43789193 |
aggctaaaatatggttttagttcctgcaaatatgcttcgttttggt |
43789148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 20658411 - 20658367
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
20658411 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttg |
20658367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 23732039 - 23732083
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
23732083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 27109073 - 27109117
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggt |
27109117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 33733241 - 33733197
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
33733197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 34317798 - 34317842
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggt |
34317842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 40124966 - 40125010
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
40125010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 215
Target Start/End: Complemental strand, 4794468 - 4794429
Alignment:
| Q |
176 |
aaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggt |
4794429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 5164487 - 5164444
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
5164487 |
taggttaaaatatggttttgattcctgcaaatatgtcttgtttt |
5164444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 26238816 - 26238855
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttg |
26238855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 35155620 - 35155577
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| |||||| |
|
|
| T |
35155620 |
aggctaaaatatggttttggtccctgaaaatatgtcttgttttg |
35155577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 42696202 - 42696159
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
42696159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 44073808 - 44073765
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
44073808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
44073765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 45442315 - 45442358
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttg |
45442358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 3837932 - 3837974
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
3837932 |
aggctaaaatatagttttagtccctgcaaatatgtctcgtttt |
3837974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 9195208 - 9195162
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
9195208 |
taggctaaaatatggttttagaccctgcaaatatgcctcgttttggt |
9195162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 17912447 - 17912493
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
17912447 |
taggttaaaatatgattttagtccctgcaaatatgtctcgttttggt |
17912493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 23989836 - 23989882
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
23989836 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
23989882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 27311071 - 27311025
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
27311071 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttggt |
27311025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 29182440 - 29182398
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
29182398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 32691636 - 32691594
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
32691636 |
aggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 34318083 - 34318041
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttg |
34318041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 35155298 - 35155336
Alignment:
| Q |
177 |
aatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggt |
35155336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 40786458 - 40786504
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40786458 |
taggctaaaatatggttttattcactgcaaatatgtctcgttttggt |
40786504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 43592044 - 43592090
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
43592044 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggt |
43592090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 44985623 - 44985665
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
44985665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 44994062 - 44994020
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
44994062 |
aggctaaaatatggttttaatccctgcaaatatgtctcgtttt |
44994020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 2265398 - 2265353
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || | |||||||||||||||||||||| |
|
|
| T |
2265398 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggt |
2265353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 3172019 - 3172064
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||| ||||||| |
|
|
| T |
3172019 |
aggctaaaatatgattttggtccctgcaaatatgcctcattttggt |
3172064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 3172533 - 3172488
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||||| | |||||||||| ||||||||||| |
|
|
| T |
3172533 |
aggctaaaatatgattttggtccttgcaaatatgcctcgttttggt |
3172488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 5006610 - 5006651
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
5006610 |
taaaatatggttttggtctctgcaaatatatctcgttttggt |
5006651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 8046328 - 8046373
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
8046328 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
8046373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 11713846 - 11713801
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| |||||| || |||||||||||| ||||||||||| |
|
|
| T |
11713846 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggt |
11713801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 14393129 - 14393085
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
14393129 |
aggctaaaatatgatttag-ttcctgcaaatatgtctcgttttggt |
14393085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 203
Target Start/End: Original strand, 23861747 - 23861784
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatg |
203 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
23861747 |
atataggctaaaatatgtttttggtccctgcaaatatg |
23861784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 23990193 - 23990152
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggt |
23990152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 25954114 - 25954159
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || ||||||||||||| |||||||||| |
|
|
| T |
25954114 |
aggctaaaatatgtttttagtccctgcaaatatgtttcgttttggt |
25954159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 32476094 - 32476139
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||| ||||||| |
|
|
| T |
32476094 |
aggctaaaatatggttttgatccctgcaaatatgcctcattttggt |
32476139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 36815483 - 36815532
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
36815483 |
atataggctaaaatatggttttgccctctgtaaatatgtctcgttttggt |
36815532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 37229039 - 37228998
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggt |
37228998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 38731828 - 38731873
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||| ||||||||||| |
|
|
| T |
38731828 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggt |
38731873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 42358702 - 42358743
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggt |
42358743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 43597500 - 43597455
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || ||||| |||||||||||||||||| |
|
|
| T |
43597500 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggt |
43597455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 45442697 - 45442652
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || | |||||||||||||||||||||| |
|
|
| T |
45442697 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggt |
45442652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 3671001 - 3671045
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| || | |||||||||| ||||||||| |
|
|
| T |
3671001 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttg |
3671045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 3671192 - 3671148
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggt |
3671148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 5790558 - 5790602
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || || |||||||||||| ||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggt |
5790602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 8046648 - 8046604
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || ||| |||||||| ||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggt |
8046604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 13850514 - 13850566
Alignment:
| Q |
163 |
taaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||| |||||| | |||||||||||||||| |||||| |
|
|
| T |
13850514 |
taaaaataggctaaaatatagttttgatctctgcaaatatgtctcgatttggt |
13850566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 18113454 - 18113410
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggt |
18113410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 31226077 - 31226033
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggt |
31226033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 41694003 - 41693959
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
41693959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 41791312 - 41791268
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
41791268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 8e-20; HSPs: 169)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 47336590 - 47336537
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47336590 |
ttaaatataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
47336537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 474412 - 474364
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
474412 |
tataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
474364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 54608867 - 54608819
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54608867 |
tataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
54608819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 28427242 - 28427289
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28427242 |
ataggctaaaatatggttttagttcctgcaaatatgtctcgttttggt |
28427289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 12740905 - 12740951
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12740905 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
12740951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 29490745 - 29490699
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29490745 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
29490699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 51550448 - 51550402
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51550448 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
51550402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 474043 - 474088
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
474043 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
474088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 12741272 - 12741227
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12741272 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
12741227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 4034717 - 4034761
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
4034761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 26090078 - 26090034
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
26090034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 30130154 - 30130202
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
30130154 |
tataggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
30130202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 43441270 - 43441314
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
43441314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 53701671 - 53701619
Alignment:
| Q |
163 |
taaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
53701671 |
taaatatgggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
53701619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 9262158 - 9262111
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
9262158 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
9262111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 11463233 - 11463276
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggt |
11463276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 30106227 - 30106176
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
30106227 |
aaatataggctaaaatatggttttggtccctgcaaatatacctcgttttggt |
30106176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 45002018 - 45002065
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
45002018 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
45002065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 53113442 - 53113485
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53113442 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
53113485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 9603623 - 9603673
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
9603623 |
aatataggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
9603673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 13514579 - 13514533
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
13514579 |
taggctaaaatatgattttggtacctgcaaatatgtctcgttttggt |
13514533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 15979703 - 15979657
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
15979703 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggt |
15979657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 28552385 - 28552339
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28552385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
28552339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 30128282 - 30128328
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30128282 |
taggctaaaatatggttttggtccctgcaaacatgtctcgttttggt |
30128328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 34238596 - 34238642
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
34238596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
34238642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 47005153 - 47005195
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47005153 |
aggctaaaatatggttttggtccctgcaaatatgtctcgtttt |
47005195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 51550080 - 51550126
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
51550080 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
51550126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 4814539 - 4814584
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
4814539 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
4814584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 22008525 - 22008570
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
22008525 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
22008570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 22008899 - 22008846
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| | |||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
22008899 |
ttaaattttggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
22008846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 22016043 - 22016088
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
22016043 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
22016088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 25615974 - 25616019
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25615974 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
25616019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 28942906 - 28942861
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
28942906 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggt |
28942861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 29446211 - 29446162
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
29446211 |
atataggctaaaatatggttttagtccctgcaaatatgtcttgttttggt |
29446162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 31480135 - 31480180
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
31480135 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
31480180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 35177254 - 35177299
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
35177254 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggt |
35177299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 35569133 - 35569092
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggt |
35569092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 39288572 - 39288617
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
39288572 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
39288617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 39436717 - 39436762
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
39436717 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
39436762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 47114486 - 47114531
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
47114486 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggt |
47114531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 51759818 - 51759863
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
51759818 |
aggctaaaatatggttctagttcctgcaaatatgtctcgttttggt |
51759863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 54608517 - 54608562
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
54608517 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
54608562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 9603923 - 9603875
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
9603923 |
tataggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
9603875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 22155927 - 22155971
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
22155927 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
22155971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 40370589 - 40370545
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
40370545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 49323782 - 49323826
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
49323826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 3152118 - 3152067
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
3152118 |
aaatttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
3152067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 21159452 - 21159495
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
21159452 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
21159495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 28552019 - 28552062
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
28552019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
28552062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 30034475 - 30034428
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
30034475 |
ataggctaaaatatggttttgctccttgcaaatatgtctcgttttggt |
30034428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 31869958 - 31869915
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
31869958 |
taggctaaaatatggttttagtccctgcaaatatgtctcgtttt |
31869915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 32119218 - 32119261
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
32119218 |
taggctaaaatatagttttggtccctgcaaatatgtctcgtttt |
32119261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 37506864 - 37506911
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
37506864 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
37506911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 38232240 - 38232283
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
38232240 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttg |
38232283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 40545562 - 40545605
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
40545562 |
taggctaaaatatggttttggtccctgcaaatatgactcgtttt |
40545605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 49324149 - 49324102
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
49324149 |
ataggataaaatatggttttggtccctgtaaatatgtctcgttttggt |
49324102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 3151748 - 3151794
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
3151748 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
3151794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 3830518 - 3830472
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
3830518 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
3830472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 21159819 - 21159773
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
21159819 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
21159773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 21553888 - 21553930
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
21553888 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
21553930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 27681688 - 27681638
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
27681688 |
aatataggctaaaatatggttctggtctctgcaaatatgcctcgttttggt |
27681638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 28452145 - 28452191
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||| |||||||| |
|
|
| T |
28452145 |
taggctaaaatatggttttggtccttgcaaatatgtcttgttttggt |
28452191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 29525104 - 29525146
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
29525104 |
aggctaaaatatggttttagtccctgcaaatatgtctcgtttt |
29525146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 31869596 - 31869638
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggt |
31869638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 38232594 - 38232556
Alignment:
| Q |
177 |
aatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggt |
38232556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 39072213 - 39072171
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttg |
39072171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 40169654 - 40169612
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
40169612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 46622131 - 46622085
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
46622131 |
taggctaaaatatggttttggtccttgcaaatatgtttcgttttggt |
46622085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 47005521 - 47005475
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
47005521 |
taggctaaaatatggttttggtccctgcaaatattcctcgttttggt |
47005475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 52342193 - 52342239
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
52342193 |
taggctaaaatatggttttggtccctgcaaatatgcctccttttggt |
52342239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 863659 - 863610
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||| ||| ||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
863659 |
aaataaaggttaaaatatggttttggtccctgcaaatatgtttcgttttg |
863610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 1721453 - 1721408
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
1721453 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
1721408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 3387268 - 3387309
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggt |
3387309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 3387605 - 3387560
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
3387605 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggt |
3387560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 4035053 - 4035012
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
4035012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 4513262 - 4513307
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
4513262 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
4513307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 4513621 - 4513576
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4513621 |
aggctaaaatatggttttactccctgcaaatatgtctcgttttggt |
4513576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 4814899 - 4814855
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
4814899 |
aggctaaaatatggttttagt-cctgcaaatatgtctcgttttggt |
4814855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 4950036 - 4950081
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
4950036 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
4950081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 8940522 - 8940481
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggt |
8940481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 14772210 - 14772255
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
14772210 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
14772255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 19844582 - 19844537
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
19844582 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
19844537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 20612899 - 20612854
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
20612899 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
20612854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 25610129 - 25610088
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttg |
25610088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 28427609 - 28427564
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
28427609 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
28427564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 32119585 - 32119540
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
32119585 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggt |
32119540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 37507223 - 37507178
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
37507223 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
37507178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 39288907 - 39288854
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| ||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
39288907 |
ttaaatttaggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
39288854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 39437110 - 39437065
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
39437110 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
39437065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 40370285 - 40370326
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgtttt |
40370326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 43441604 - 43441559
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
43441604 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
43441559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 44802549 - 44802504
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
44802549 |
aggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 45002386 - 45002341
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
45002386 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggt |
45002341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 47336227 - 47336272
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
47336227 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
47336272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 48924241 - 48924196
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
48924241 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggt |
48924196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 51834607 - 51834652
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
51834607 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
51834652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 9261789 - 9261833
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggt |
9261833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 10976978 - 10977022
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
10977022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 15979338 - 15979382
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
15979382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 25710508 - 25710552
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
25710508 |
taggctcaaatatggttttagtccctgcaaatatgtctcgttttg |
25710552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 25710870 - 25710826
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
25710826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 26089730 - 26089774
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
26089774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 28942521 - 28942569
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
28942521 |
tataggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
28942569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 31480500 - 31480456
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggt |
31480456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 212
Target Start/End: Complemental strand, 35407793 - 35407749
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
35407793 |
ataggctaaaatatggttttgatccctgcaaatatgtcttgtttt |
35407749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 36672959 - 36673007
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
36672959 |
tataggataaaatatggttttggtctctgcaaatatgtcttgttttggt |
36673007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 212
Target Start/End: Original strand, 43440488 - 43440536
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||| |||||||||||||||||| || | ||||||||||||||||||| |
|
|
| T |
43440488 |
aaataaaggctaaaatatggttttagtccttgcaaatatgtctcgtttt |
43440536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 46901100 - 46901148
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
46901100 |
tataggctaaaatatggttttagtctctgcaaatatgtatcgttttggt |
46901148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 863279 - 863322
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
863279 |
taggctaaaatatgattttggtccatgcaaatatgtctcgtttt |
863322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 210
Target Start/End: Original strand, 18175791 - 18175830
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtt |
210 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcgtt |
18175830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 22156292 - 22156249
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
22156249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 39132908 - 39132873
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgt |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39132908 |
taggctaaaatatggttttggtccctgcaaatatgt |
39132873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 40169343 - 40169386
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
40169343 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttg |
40169386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 45005889 - 45005928
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttg |
45005928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 1721087 - 1721133
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
1721087 |
taggttaaaatatggttttggtccttgcaaatatgtctcattttggt |
1721133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 2486900 - 2486858
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
2486858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 3830132 - 3830178
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||| ||||||| |
|
|
| T |
3830132 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggt |
3830178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 7518444 - 7518402
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggt |
7518402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 7588316 - 7588362
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| || |||||||| |
|
|
| T |
7588316 |
taggctaaaatatagttttggtccctgcaaatatgccttgttttggt |
7588362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 14633547 - 14633589
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
14633589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 20404888 - 20404934
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| |||| |
|
|
| T |
20404888 |
taggctaaaatatggttttgcttcctgcaaatatacctcgttatggt |
20404934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 20644505 - 20644547
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttg |
20644547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 215
Target Start/End: Complemental strand, 25610061 - 25610027
Alignment:
| Q |
181 |
tggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggt |
25610027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 28452378 - 28452332
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
28452378 |
taggctaaaatatggttttggtccctacaaatatgcttcgttttggt |
28452332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 29955668 - 29955622
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
29955668 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggt |
29955622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 30004823 - 30004777
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
30004823 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggt |
30004777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 35533281 - 35533323
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggt |
35533323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 202
Target Start/End: Complemental strand, 39820666 - 39820632
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatat |
202 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39820666 |
ataggctaaaatatggttttggtccctgcaaatat |
39820632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 44802276 - 44802326
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
44802276 |
aatattggctaaaatatggttttagtccctgcaaatatgcgtcgttttggt |
44802326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 45313863 - 45313821
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttg |
45313821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 50196301 - 50196343
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
50196343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 51834944 - 51834898
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
51834944 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
51834898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 275441 - 275486
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||| ||||||||| |
|
|
| T |
275441 |
ataggctaaaatatggttttagtccctgcaactatgcctcgttttg |
275486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 4322186 - 4322145
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggt |
4322145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 5345690 - 5345645
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
5345690 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
5345645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 9597096 - 9597051
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| |||||||||| |
|
|
| T |
9597096 |
aggctaaaatatggttttgttccctgcaaatatgcttcgttttggt |
9597051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 13584368 - 13584323
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
13584368 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
13584323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 14633890 - 14633845
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||| ||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
14633890 |
aggctaaattatggttttagtccctgcaaatatgtcttgttttggt |
14633845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 19656534 - 19656583
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||| |||||||||||||||||| || | |||||||||| ||||||||| |
|
|
| T |
19656534 |
aaataaaggctaaaatatggttttagtccatgcaaatatgcctcgttttg |
19656583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 19844265 - 19844306
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgtttt |
19844306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 202
Target Start/End: Complemental strand, 20405225 - 20405192
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatat |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
20405225 |
taggctaaaatatggttttggtccctgcaaatat |
20405192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 20611019 - 20611064
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
20611019 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
20611064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 26799887 - 26799932
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||| ||||||||||| |
|
|
| T |
26799887 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggt |
26799932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 28418899 - 28418858
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | |||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttg |
28418858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 29686543 - 29686588
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||||||| |||||||| |
|
|
| T |
29686543 |
aggctagaatatggttttggtccatgcaaatatgtcttgttttggt |
29686588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 30268504 - 30268549
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
30268504 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
30268549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 30424628 - 30424669
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgtttt |
30424669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 30552479 - 30552434
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||| || | |||||||||||||||||||||| |
|
|
| T |
30552479 |
aggctaaaatatcgttttagtccatgcaaatatgtctcgttttggt |
30552434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 35565507 - 35565552
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
35565507 |
aggctaaaatatggttttgttccctgcaaatatacctcgttttggt |
35565552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 206
Target Start/End: Original strand, 39132506 - 39132539
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtct |
206 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
39132506 |
ctaaaatatggttttgattcctgcaaatatgtct |
39132539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 40277821 - 40277866
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||| |||||||||| |
|
|
| T |
40277821 |
aggctaaaatgtggttttggtccctgcaaatatgcttcgttttggt |
40277866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 40545836 - 40545795
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggt |
40545795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 40979711 - 40979666
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
40979711 |
aggctaaaatatggttttaatccctgcaaatatggctcgttttggt |
40979666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 45161116 - 45161157
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggt |
45161157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 45320980 - 45320935
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
45320980 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
45320935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 46186772 - 46186727
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
46186772 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggt |
46186727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 46751270 - 46751315
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
46751270 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
46751315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 202
Target Start/End: Complemental strand, 47433870 - 47433837
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatat |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
47433870 |
taggctaaaatatggttttggtccctgcaaatat |
47433837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 51500686 - 51500641
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| | || |||||||||||| ||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggt |
51500641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 52342584 - 52342539
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
52342584 |
aggctaaaatatggtttttgtctctgcaaatatgcctcgttttggt |
52342539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 7957226 - 7957182
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| |||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggt |
7957182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 8510214 - 8510258
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| ||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggt |
8510258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 9863404 - 9863360
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggt |
9863360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 15016388 - 15016432
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
15016432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 16123139 - 16123183
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||| ||||||| ||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggt |
16123183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 29445954 - 29445998
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
29445998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 213
Target Start/End: Original strand, 29955300 - 29955340
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttg |
29955340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 213
Target Start/End: Original strand, 30004454 - 30004494
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttg |
30004494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 212
Target Start/End: Complemental strand, 50196660 - 50196616
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| || ||| |||||||| |||||||| |
|
|
| T |
50196660 |
ataggctaaaatatggttttagtccctacaaatatgcctcgtttt |
50196616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 137)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 5917117 - 5917170
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5917117 |
ttaattataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
5917170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 19685014 - 19685061
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19685014 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
19685061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 20690730 - 20690777
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20690730 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
20690777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 35877054 - 35877008
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35877054 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
35877008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 1381246 - 1381291
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1381246 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
1381291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 18258528 - 18258483
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18258528 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
18258483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 19565466 - 19565511
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19565466 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
19565511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 24443749 - 24443700
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24443749 |
atataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
24443700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 31037750 - 31037697
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| ||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
31037750 |
ttaaatttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
31037697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 38182088 - 38182043
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38182088 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggt |
38182043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 38189043 - 38189088
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38189043 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggt |
38189088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 38209314 - 38209269
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38209314 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggt |
38209269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 38216268 - 38216313
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38216268 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggt |
38216313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 45138 - 45182
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
45182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 5104001 - 5103957
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggt |
5103957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 26133421 - 26133369
Alignment:
| Q |
163 |
taaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| |||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
26133421 |
taaataaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
26133369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 30888160 - 30888204
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
30888204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 35928458 - 35928414
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
35928414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 36577719 - 36577766
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
36577719 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
36577766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 37271707 - 37271664
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37271707 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
37271664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 1105150 - 1105104
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1105150 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
1105104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 215
Target Start/End: Original strand, 4736195 - 4736249
Alignment:
| Q |
161 |
gttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4736195 |
gttaaatttaggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 6912855 - 6912813
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
6912813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 19565833 - 19565787
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19565833 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
19565787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 30800488 - 30800538
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
30800488 |
aatataggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
30800538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 35609635 - 35609593
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
35609593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 1381612 - 1381567
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1381612 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
1381567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 4736543 - 4736498
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
4736543 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggt |
4736498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 5917461 - 5917416
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5917461 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
5917416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 17070534 - 17070575
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttt |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17070534 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttt |
17070575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 19685381 - 19685336
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19685381 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
19685336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 20660947 - 20660992
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
20660947 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
20660992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 29151852 - 29151807
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
29151852 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggt |
29151807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 35928063 - 35928108
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35928063 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
35928108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 38170513 - 38170558
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
38170513 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
38170558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 40764414 - 40764459
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
40764414 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
40764459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 40764789 - 40764736
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| ||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
40764789 |
ttaaataaaggctaaaatatggttttgctccctgcaaatatgcctcgttttggt |
40764736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 1104856 - 1104900
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
1104856 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttg |
1104900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 2636669 - 2636713
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggt |
2636713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 4203772 - 4203728
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
4203772 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
4203728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 6912497 - 6912541
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
6912541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 213
Target Start/End: Complemental strand, 12145181 - 12145141
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttg |
12145141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 23381946 - 23381994
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
23381946 |
tataggctaaaatatggttttagtccctgcaaatatgtctggttttggt |
23381994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 29366949 - 29366905
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
29366905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 213
Target Start/End: Complemental strand, 38452394 - 38452354
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttg |
38452354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 42553642 - 42553686
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggt |
42553686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 2636992 - 2636949
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
2636949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 3850606 - 3850555
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||| |||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
3850606 |
aaatgtaggctgaaatatggttttagtccctgcaaatatgtctcgttttggt |
3850555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 5614165 - 5614208
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
5614165 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
5614208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 18046037 - 18046080
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
18046037 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
18046080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 20986090 - 20986047
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
20986090 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttg |
20986047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 24781986 - 24782033
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
24781986 |
ataggctaaaatatggttttagtcactgcaaatatgtctcgttttggt |
24782033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 32108806 - 32108849
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
32108806 |
taggctaaaatatggttttggtccctgcaaatatgtttcgtttt |
32108849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 5614532 - 5614486
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
5614532 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
5614486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 5950174 - 5950220
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
5950174 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
5950220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 7075566 - 7075616
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
7075566 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
7075616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 10744056 - 10744010
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
10744056 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggt |
10744010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 14318043 - 14318089
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
14318043 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggt |
14318089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 18046350 - 18046304
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
18046350 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
18046304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 18286426 - 18286472
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
18286426 |
taggttaaaatatggttttagttcctgcaaatatgtcttgttttggt |
18286472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 20691094 - 20691052
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggt |
20691052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 25562001 - 25561955
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
25562001 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
25561955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 29692742 - 29692788
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
29692742 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
29692788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 29875727 - 29875681
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
29875727 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
29875681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 30800852 - 30800806
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
30800852 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
30800806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 36973710 - 36973668
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttg |
36973668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 37271357 - 37271403
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
37271357 |
taggctaaaatatggttttggtctctgcaaatatgcctcgttttggt |
37271403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 42596826 - 42596776
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||| || ||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
42596826 |
ttaaatattggttaaaatatggttttggtccctgcaaatatgactcgtttt |
42596776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 45501 - 45460
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggt |
45460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 2217493 - 2217538
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
2217493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
2217538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 2217855 - 2217810
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
2217810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 4203455 - 4203500
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
4203455 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
4203500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 10743723 - 10743768
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
10743723 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
10743768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 16038376 - 16038421
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
16038376 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
16038421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 212
Target Start/End: Complemental strand, 17070867 - 17070822
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||||||||||||||| |
|
|
| T |
17070867 |
tataggctaaaatatggttttagtccctacaaatatgtctcgtttt |
17070822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 18258161 - 18258206
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
18258161 |
aggctaaaatatggttttggtccctgcaaatatggctcattttggt |
18258206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 18633598 - 18633643
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
18633598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
18633643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 20416359 - 20416404
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
20416359 |
aggctaaaatatggttttcgtccctgcaaatatgtctcgctttggt |
20416404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 20985728 - 20985769
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggt |
20985769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 21124912 - 21124957
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
21124912 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggt |
21124957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 24443379 - 24443424
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
24443379 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
24443424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 28213372 - 28213417
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
28213372 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
28213417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 28550818 - 28550871
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| | ||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
28550818 |
ttaaattttggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
28550871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 28863509 - 28863554
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
28863509 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
28863554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 28871995 - 28871950
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28871995 |
aggctaaattatggttttggtccctgcaaatatgcctcgttttggt |
28871950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 29172887 - 29172842
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
29172887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
29172842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 35167166 - 35167121
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
35167166 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
35167121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 35876687 - 35876732
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
35876687 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
35876732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 36578084 - 36578039
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
36578084 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
36578039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 38496783 - 38496738
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
38496783 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggt |
38496738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 40029140 - 40029185
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
40029140 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggt |
40029185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 40029506 - 40029453
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
40029506 |
ttaaataatggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
40029453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 40038491 - 40038536
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
40038491 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
40038536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 2032940 - 2032896
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggt |
2032896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 6118499 - 6118455
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
6118455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 10409328 - 10409284
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
10409328 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
10409284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 15916286 - 15916330
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggt |
15916330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 18633961 - 18633917
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
18633917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 28863838 - 28863794
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
28863794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 33336026 - 33335982
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggt |
33335982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 36973353 - 36973397
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggt |
36973397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 38962806 - 38962850
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggt |
38962850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 293827 - 293870
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
293827 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
293870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 10408927 - 10408970
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
10408927 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
10408970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 29172524 - 29172567
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
29172567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 40168011 - 40167964
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| ||||| || | |||||||||||||||||||||| |
|
|
| T |
40168011 |
ataggctaaaatattgttttagtccatgcaaatatgtctcgttttggt |
40167964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 31602137 - 31602187
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||| |||||||||| |
|
|
| T |
31602137 |
aatataggctaaaatatagttttgatccctgcaaatatgcatcgttttggt |
31602187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 31602519 - 31602473
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||| ||||| |||| | |||||||||||||||||| |
|
|
| T |
31602519 |
tataggctaaaatatagttttagttcatacaaatatgtctcgttttg |
31602473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 34125305 - 34125351
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||| || |||||||||||| ||||||||||| |
|
|
| T |
34125305 |
taggctaaaatatagttttagtccctgcaaatatgcctcgttttggt |
34125351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 35166160 - 35166114
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| ||||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
35166160 |
taggctataatatggttttagtccctgcaaaaatgtctcgttttggt |
35166114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 39379612 - 39379566
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
39379612 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
39379566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 42207240 - 42207286
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || | || ||||||||||||||||||| |
|
|
| T |
42207240 |
taggctaaaatatggttttagtccttgtaaatatgtctcgttttggt |
42207286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 42994068 - 42994110
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttg |
42994110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 1287042 - 1287001
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggt |
1287001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 3851336 - 3851287
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| || ||| ||||||||||||||||| |
|
|
| T |
3851336 |
aaatgtaggctaaaatatggttttagtccctcaaaatatgtctcgttttg |
3851287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 9179921 - 9179876
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
9179921 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggt |
9179876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 11799459 - 11799414
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggt |
11799414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 13990896 - 13990851
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| |||||| || |||||||||||| ||||||||||| |
|
|
| T |
13990896 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggt |
13990851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 15635708 - 15635663
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || || ||||||||| ||||||||||| |
|
|
| T |
15635708 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggt |
15635663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 26071290 - 26071335
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||| ||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggt |
26071335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 26071613 - 26071572
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggt |
26071572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 28108159 - 28108118
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggt |
28108118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 35166910 - 35166955
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
35166910 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
35166955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 38786158 - 38786203
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
38786158 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
38786203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 39808079 - 39808128
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||| |||||||||||||||||||||| | | ||||||||||| ||||| |
|
|
| T |
39808079 |
aaataaaggctaaaatatggttttggtttccgtaaatatgtctctttttg |
39808128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 40167785 - 40167830
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||| ||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
40167785 |
aggctaaagtatggttttagtccctgcaaatatgcctcgttttggt |
40167830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 1286682 - 1286726
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||| ||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggt |
1286726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 3850299 - 3850343
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || ||||||||| || ||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggt |
3850343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 5103648 - 5103692
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||| ||||||||||| |
|
|
| T |
5103648 |
ggctaaaatatgattttggttcatgtaaatatgactcgttttggt |
5103692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 5904006 - 5904050
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||| ||||||||| |
|
|
| T |
5904006 |
taggctaaaatatggttttgctccttgcaaatatgcctcgttttg |
5904050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 9588611 - 9588567
Alignment:
| Q |
172 |
gctaaaatatggtttt-ggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggt |
9588567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 20661311 - 20661267
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggt |
20661267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 23382297 - 23382253
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
23382253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 25561705 - 25561749
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggt |
25561749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 26133183 - 26133227
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || ||| |||||||| ||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggt |
26133227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 35609303 - 35609347
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggt |
35609347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 40038858 - 40038814
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| || |||||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggt |
40038814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 171)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 31812214 - 31812169
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31812214 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
31812169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 42848026 - 42848071
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42848026 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
42848071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 26412183 - 26412234
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
26412183 |
aaatataggctaaaatatggttttgatccctgcaaatatgtctcgttttggt |
26412234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 53916050 - 53916003
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53916050 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
53916003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 9289260 - 9289310
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
9289260 |
aatataggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
9289310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 12152495 - 12152449
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12152495 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
12152449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 13631226 - 13631272
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13631226 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
13631272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 14791812 - 14791762
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14791812 |
aataaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
14791762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 29420539 - 29420493
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29420539 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
29420493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 35464016 - 35464062
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35464016 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
35464062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 11693124 - 11693079
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11693124 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
11693079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 13073750 - 13073803
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| | |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13073750 |
ttaaatcttggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
13073803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 25423923 - 25423968
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25423923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
25423968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 25424313 - 25424268
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25424313 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
25424268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 35119616 - 35119567
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35119616 |
atataggctaaaatatggttttggtcactgcaaatatgtctcgttttggt |
35119567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 43231087 - 43231132
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43231087 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
43231132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 13764613 - 13764657
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
13764657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 4211554 - 4211605
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4211554 |
aaatctaggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
4211605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 51738134 - 51738181
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
51738134 |
ataggctaaaatatggttttggtccctacaaatatgtctcgttttggt |
51738181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 13479613 - 13479567
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
13479613 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
13479567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 14487800 - 14487846
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
14487800 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
14487846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 14488189 - 14488143
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
14488189 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
14488143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 19903653 - 19903611
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
19903611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 23245597 - 23245551
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
23245597 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggt |
23245551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 30046798 - 30046748
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30046798 |
aataaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
30046748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 30061139 - 30061089
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30061139 |
aataaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
30061089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 36050282 - 36050332
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| ||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
36050282 |
aatatacgctaaaatatggttttggtccccgcaaatatgtctcgttttggt |
36050332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 42823774 - 42823820
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
42823774 |
taggctaaaatatgattttggtccctgcaaatatgtctcgttttggt |
42823820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 43231395 - 43231345
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
43231395 |
aataaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
43231345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 46088062 - 46088016
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
46088062 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
46088016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 53915679 - 53915725
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
53915679 |
tataggctaaaatatggttttggtccctgcaaatatgcctcgttttg |
53915725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 2322433 - 2322388
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
2322433 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggt |
2322388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 5827974 - 5827929
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5827974 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggt |
5827929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 12152149 - 12152194
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttt |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
12152149 |
atataggctaaaatatggttttggtccctgcaaatatgactcgttt |
12152194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 13530376 - 13530421
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
13530376 |
ataggctaaaatatggttttgctccctgcaaatatgtctcgttttg |
13530421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 13530714 - 13530669
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
13530714 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
13530669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 13631600 - 13631555
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
13631600 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggt |
13631555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 20144732 - 20144687
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
20144732 |
aggctaaaatatggttttggttcatgcaaatatgcctcgttttggt |
20144687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 22099913 - 22099868
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
22099913 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
22099868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 24474964 - 24474919
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
24474964 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
24474919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 24774044 - 24774089
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24774044 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
24774089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 29380911 - 29380866
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
29380911 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
29380866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 29499181 - 29499226
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29499181 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
29499226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 31182505 - 31182460
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31182505 |
aggctaaaatatggttttaattcctgcaaatatgtctcgttttggt |
31182460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 34361802 - 34361847
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
34361802 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
34361847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 44925484 - 44925529
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
44925484 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggt |
44925529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 46115409 - 46115458
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
46115409 |
atattggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
46115458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 46128543 - 46128592
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
46128543 |
atattggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
46128592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 52441760 - 52441805
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
52441760 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
52441805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 52543421 - 52543466
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
52543421 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggt |
52543466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 53716916 - 53716965
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
53716916 |
atataggctaaaatatggttttagtccctgcaaatatgtcttgttttggt |
53716965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 54208822 - 54208781
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggt |
54208781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 5827655 - 5827699
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
5827699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 19321859 - 19321815
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggt |
19321815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 23245231 - 23245275
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
23245275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 26412584 - 26412540
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggt |
26412540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 31560695 - 31560651
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
31560651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 35464382 - 35464338
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
35464338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 42848391 - 42848347
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
42848347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 46292392 - 46292436
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
46292436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 47274230 - 47274186
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggt |
47274186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 50714565 - 50714521
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
50714521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 53308068 - 53308024
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggt |
53308024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 5797823 - 5797776
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
5797823 |
ataggttaaaatatggttttggtccctacaaatatgtctcgttttggt |
5797776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 13479273 - 13479316
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
13479316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 20291983 - 20292030
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
20291983 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggt |
20292030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 22584284 - 22584331
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
22584284 |
ataggctaaaatatggttttagtccttgcaaatatgtctcgttttggt |
22584331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 28449215 - 28449172
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
28449215 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttg |
28449172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 36701999 - 36702042
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
36701999 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
36702042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 47136170 - 47136127
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggt |
47136127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 52430102 - 52430059
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
52430102 |
taggctaaaatatggttttagtccctgcaaatatgtctcgtttt |
52430059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 9289641 - 9289595
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
9289641 |
taggcttaaatatggttttagtccctgcaaatatgtctcgttttggt |
9289595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 13074127 - 13074081
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
13074127 |
taggctaaaatatggttttggtccctgcaaatatacctcgttttggt |
13074081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 207
Target Start/End: Original strand, 14594204 - 14594242
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctc |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14594204 |
taggctaaaatatggttttggtccctgcaaatatgtctc |
14594242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 18205521 - 18205479
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
18205479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 30060765 - 30060811
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
30060765 |
tataggttaaaatatggttttggtccctgcaaatatgcctcgttttg |
30060811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 32365092 - 32365138
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
32365092 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
32365138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 35763645 - 35763691
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
35763645 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
35763691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 41346220 - 41346174
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
41346220 |
taggctaaaatatggttttagtccctgcaaatatgtctcattttggt |
41346174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 42824091 - 42824049
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttg |
42824049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 45593588 - 45593542
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
45593588 |
taggctaaaatatggttttagtctctgcaaatatgtctcgttttggt |
45593542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 47023107 - 47023061
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
47023107 |
taggctaaaatatggttttgatccctgcaaatatgtttcgttttggt |
47023061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 51708691 - 51708737
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
51708691 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggt |
51708737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 8904885 - 8904930
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
8904885 |
aggctaaaatatagttttggtccctgcaaatatgcctcgttttggt |
8904930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 13064466 - 13064421
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
13064466 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
13064421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 13764808 - 13764763
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
13764808 |
aggctaaaatatggttttggtccctgtaaatatgtttcgttttggt |
13764763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 16712692 - 16712647
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
16712692 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
16712647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 18205155 - 18205200
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
18205155 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
18205200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 23778963 - 23779008
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
23778963 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
23779008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 26314333 - 26314288
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
26314333 |
aggctaaaatatggttttgatccctgaaaatatgtctcgttttggt |
26314288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 29380667 - 29380712
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
29380667 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggt |
29380712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 29463914 - 29463869
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
29463914 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
29463869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 29499543 - 29499502
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggt |
29499502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 31811924 - 31811969
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
31811924 |
aggctaaaatatggttttgatccctgcaaatatgtatcgttttggt |
31811969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 32208541 - 32208586
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
32208541 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
32208586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 32365484 - 32365439
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
32365484 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggt |
32365439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 41345852 - 41345897
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
41345852 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
41345897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 45505895 - 45505850
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
45505895 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
45505850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 46115780 - 46115735
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
46115780 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggt |
46115735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 46128914 - 46128869
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
46128914 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggt |
46128869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 47022743 - 47022784
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggt |
47022784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 51545974 - 51545925
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| |||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
51545974 |
atataggttaaaatatggttttagtccctgcaaatatgcctcgttttggt |
51545925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 52017504 - 52017549
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
52017504 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
52017549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 52017871 - 52017826
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
52017871 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
52017826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 52442093 - 52442048
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
52442093 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggt |
52442048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 54903476 - 54903431
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| | ||||||||| |
|
|
| T |
54903476 |
aggctaaaatatggttttggtccctgcaaatatgccccgttttggt |
54903431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 13064157 - 13064201
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
13064157 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
13064201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 22099543 - 22099587
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
22099587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 25358540 - 25358496
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggt |
25358496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 29463610 - 29463654
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggt |
29463654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 35415633 - 35415589
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
35415589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 46292659 - 46292607
Alignment:
| Q |
163 |
taaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| |||||||||||||||||| || |||||||||||| ||| ||||||| |
|
|
| T |
46292659 |
taaataaaggctaaaatatggttttagtccctgcaaatatgcctcattttggt |
46292607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 51738413 - 51738369
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||||| |
|
|
| T |
51738413 |
taggctaaaatatggttttggtccatgcaaatatgcctcgttttg |
51738369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 53717174 - 53717130
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
53717130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 55072716 - 55072668
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
55072716 |
tataggttaaaatatggttttagtccctgcaaatatgcctcgttttggt |
55072668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 123531 - 123578
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| ||| ||||||| |
|
|
| T |
123531 |
ataggctaaaatatggttttagtccctgcaaatatgcctcattttggt |
123578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 2322094 - 2322137
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggt |
2322137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 5882545 - 5882595
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
5882545 |
aaatttaggctaaaatatggttttagt-cctgcaaatatgcctcgttttggt |
5882595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 6353637 - 6353594
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggt |
6353594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 7639897 - 7639940
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggt |
7639940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 15555637 - 15555594
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggt |
15555594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 35415292 - 35415343
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| || |||| ||||||| |||||||||| |
|
|
| T |
35415292 |
aaatataggctaaaatatggttttagtccctgtaaatatgcatcgttttggt |
35415343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 36702362 - 36702319
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggt |
36702319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 215
Target Start/End: Complemental strand, 47532667 - 47532628
Alignment:
| Q |
176 |
aaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggt |
47532628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 4279020 - 4279066
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
4279020 |
taggctaaaatatggttttagcccctgcaaatatatctcgttttggt |
4279066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 212
Target Start/End: Original strand, 5202929 - 5202967
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttt |
5202967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 215
Target Start/End: Original strand, 6827532 - 6827590
Alignment:
| Q |
157 |
gattgttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
6827532 |
gattgttaaaataaggctaaaatatggttttagtccttgcaaatatgcctcgttttggt |
6827590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 12791976 - 12791930
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
12791976 |
taggctaaaatatgatttttgtccctgcaaatatgcctcgttttggt |
12791930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 18831184 - 18831134
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| ||||||||||||||| || |||| |||||||||| |||||||| |
|
|
| T |
18831184 |
aatatagactaaaatatggttttagtccctgtaaatatgtcttgttttggt |
18831134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 212
Target Start/End: Original strand, 20144423 - 20144461
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgtttt |
20144461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 35420701 - 35420659
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggt |
35420659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 41619897 - 41619943
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
41619897 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggt |
41619943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 43368467 - 43368509
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggt |
43368509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 52543725 - 52543683
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggt |
52543683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 2034856 - 2034811
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || || ||||||||| ||||||||||| |
|
|
| T |
2034856 |
aggctaaaatatggttttagtcccagcaaatatgcctcgttttggt |
2034811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 2180219 - 2180264
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||| ||||||| |
|
|
| T |
2180219 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggt |
2180264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 5052585 - 5052540
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| ||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
5052585 |
aggctacaatatggttttagtccctgcaaatatgcctcgttttggt |
5052540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 5797484 - 5797525
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggt |
5797525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 6827875 - 6827830
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
6827875 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
6827830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 8760603 - 8760648
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
8760603 |
aggctaaaatatagttttactccctgcaaatatgtctcgttttggt |
8760648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 8760782 - 8760737
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
8760782 |
aggctaaaatatggttttagtccttgcaaatatggctcgttttggt |
8760737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 14791502 - 14791543
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggt |
14791543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 15555506 - 15555547
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggt |
15555547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 19903258 - 19903303
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||| |||||| | |||||||||||||||| ||||| |
|
|
| T |
19903258 |
ataggctaaaatatagttttgatccctgcaaatatgtctcattttg |
19903303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 23779226 - 23779181
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
23779226 |
aggctaaaatatggttttaatccctgcaaatatgtctcattttggt |
23779181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 28809181 - 28809136
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
28809181 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggt |
28809136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 31560330 - 31560375
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| |||||||||| |
|
|
| T |
31560330 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttggt |
31560375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 203
Target Start/End: Original strand, 35119291 - 35119324
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatg |
203 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
35119291 |
aggctaaaatatggttttggtccctgcaaatatg |
35119324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 35763960 - 35763911
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||| || |||||| ||||| ||||||||||| |
|
|
| T |
35763960 |
atataggctaaaatatgattttagtccctgcagatatgcctcgttttggt |
35763911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 36054151 - 36054106
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
36054151 |
aggctaaaatacggttttggtccctgcaaatatgcctcattttggt |
36054106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 37557194 - 37557153
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttg |
37557153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 38054549 - 38054590
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggt |
38054590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 41921085 - 41921040
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
41921085 |
aggctaaaatatggttttagcccctgcaaatatgtttcgttttggt |
41921040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 45505599 - 45505644
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
45505599 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
45505644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 50753925 - 50753966
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||| |||||||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggt |
50753966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 51545628 - 51545673
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
51545628 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggt |
51545673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 51709028 - 51708983
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||| ||||||| |
|
|
| T |
51709028 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggt |
51708983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 55072388 - 55072433
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
55072388 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
55072433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 202
Target Start/End: Complemental strand, 3880556 - 3880524
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatat |
202 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3880556 |
aggctaaaatatgtttttggttcctgcaaatat |
3880524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 4279335 - 4279291
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggt |
4279291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 211
Target Start/End: Complemental strand, 8191391 - 8191351
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttt |
211 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttt |
8191351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 9446323 - 9446279
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| || |||| ||||||||||||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggt |
9446279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 11692760 - 11692804
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| | ||||||| |
|
|
| T |
11692760 |
taggctaaaatgtggttttggtccctgcaaatatgccccgttttg |
11692804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 26313988 - 26314032
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggt |
26314032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 27008084 - 27008128
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| ||||| || |||||||||||| ||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggt |
27008128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 28809011 - 28809055
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || | ||||||||||| |||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggt |
28809055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 203
Target Start/End: Complemental strand, 30091118 - 30091082
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatg |
203 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |
|
|
| T |
30091118 |
tataggctaaaatatggttttggtccatgcaaatatg |
30091082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 41324890 - 41324846
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggt |
41324846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 43368777 - 43368733
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||| |
|
|
| T |
43368777 |
ggctaaaatatggttttaattccggcaaatatgtttcgttttggt |
43368733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 50714240 - 50714284
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| ||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggt |
50714284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 55805088 - 55805044
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| || |||||||| |
|
|
| T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggt |
55805044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 8e-17; HSPs: 146)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 1614555 - 1614603
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1614555 |
tataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
1614603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 23676459 - 23676408
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
23676459 |
aaatataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
23676408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 3807862 - 3807908
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3807862 |
taggctaaaatatagttttggttcctgcaaatatgtctcgttttggt |
3807908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 25988383 - 25988429
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25988383 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
25988429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 35838339 - 35838293
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35838339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
35838293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 46759656 - 46759702
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46759656 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
46759702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 8144294 - 8144339
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8144294 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
8144339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 23399977 - 23399932
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23399977 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
23399932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 25092159 - 25092204
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25092159 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
25092204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 27458398 - 27458443
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27458398 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
27458443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 35837923 - 35837968
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35837923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
35837968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 26878075 - 26878027
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
26878075 |
tataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
26878027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 29198299 - 29198347
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
29198299 |
tataggctaaaatatggttttggtccctgcaaatatatctcgttttggt |
29198347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 25988756 - 25988705
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25988756 |
aaataaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
25988705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 43300613 - 43300656
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggt |
43300656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 48192491 - 48192444
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
48192491 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
48192444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 1614910 - 1614860
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1614910 |
aataaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
1614860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 3975840 - 3975794
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3975840 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
3975794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 8144660 - 8144614
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
8144660 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
8144614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 23399610 - 23399656
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
23399610 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
23399656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 23676130 - 23676176
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23676130 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggt |
23676176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 29198664 - 29198618
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29198664 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
29198618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 39832904 - 39832950
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
39832904 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
39832950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 3975548 - 3975593
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3975548 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
3975593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 5234205 - 5234160
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
5234205 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggt |
5234160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 9659352 - 9659397
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
9659352 |
ataggctaaaatatggttttgctccctgcaaatatgtctcgttttg |
9659397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 9659690 - 9659645
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
9659690 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
9659645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 14543709 - 14543754
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
14543709 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
14543754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 30223460 - 30223505
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
30223460 |
aggctaaaatatggttttggtccccgcaaatatgtctcgttttggt |
30223505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 34878126 - 34878081
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
34878126 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggt |
34878081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 39439030 - 39438985
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
39439030 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggt |
39438985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 44344790 - 44344745
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
44344790 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
44344745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 44568691 - 44568646
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
44568691 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggt |
44568646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 45228919 - 45228874
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
45228919 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
45228874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 46828943 - 46828988
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
46828943 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggt |
46828988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 6589021 - 6589065
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
6589065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 6911247 - 6911203
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggt |
6911203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 13769774 - 13769818
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
13769818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 16853589 - 16853545
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
16853545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 19561450 - 19561406
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
19561406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 211
Target Start/End: Original strand, 28528905 - 28528945
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttt |
211 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgttt |
28528945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 35210515 - 35210471
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
35210471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 39833236 - 39833192
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggt |
39833192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 46759942 - 46759898
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggt |
46759898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 48359075 - 48359031
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
48359031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 8555806 - 8555755
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| |||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
8555806 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
8555755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 17999724 - 17999677
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
17999724 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
17999677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 19783812 - 19783859
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
19783812 |
ataggctaaaatatagttttagtccctgcaaatatgtctcgttttggt |
19783859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 28262710 - 28262757
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
28262710 |
ataggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
28262757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 35104071 - 35104122
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| |||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
35104071 |
aaataaaggctaaaatataattttggtccctgcaaatatgtctcgttttggt |
35104122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 5233802 - 5233852
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
5233802 |
aataaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
5233852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 5354766 - 5354812
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
5354766 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggt |
5354812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 23816668 - 23816714
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
23816668 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggt |
23816714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 25547490 - 25547448
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
25547448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 30709646 - 30709600
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
30709646 |
taggctaaaatatgattttagtccctgcaaatatgtctcgttttggt |
30709600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 35015224 - 35015178
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
35015224 |
tataggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
35015178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 35104297 - 35104251
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35104297 |
taggctcaaatatggttttggtccctgcaaatatgcctcgttttggt |
35104251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 39438739 - 39438785
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
39438739 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggt |
39438785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 41054238 - 41054192
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
41054238 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
41054192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 48852443 - 48852485
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
48852443 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
48852485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 6108333 - 6108378
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
6108333 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
6108378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 6847124 - 6847075
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
6847124 |
atatagactaaaatatggttttggtccctgcaaatatgcttcgttttggt |
6847075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 6892262 - 6892217
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttgg |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
6892262 |
taggctaaaatatggttttggtccctgcaaaaatgtcttgttttgg |
6892217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 11766920 - 11766961
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggt |
11766961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 12894403 - 12894358
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
12894403 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
12894358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 12932786 - 12932741
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
12932786 |
ataggctaaaatatgtttttggtccctgcaaatatgcctcgttttg |
12932741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 19465989 - 19465941
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
19465989 |
ttaaatataggctaaaatatggttttag-ccctgcaaatatgtctcgttt |
19465941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 19757747 - 19757792
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
19757747 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
19757792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 25092549 - 25092504
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
25092549 |
aggctaaaatatggttttggtccctgcaaatatgcctctttttggt |
25092504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 26877677 - 26877722
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26877677 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggt |
26877722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 27037593 - 27037634
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
27037634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 28529206 - 28529165
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggt |
28529165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 28911907 - 28911862
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
28911907 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
28911862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 30223796 - 30223751
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
30223796 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttggt |
30223751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 34877777 - 34877818
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggt |
34877818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 37372905 - 37372860
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
37372905 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
37372860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 39520397 - 39520442
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
39520397 |
aggctaaaatatggttttggtccatccaaatatgtctcgttttggt |
39520442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 44344456 - 44344497
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttt |
211 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
44344456 |
aggctaaaatatggttttagttcccgcaaatatgtctcgttt |
44344497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 44509055 - 44509010
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
44509055 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
44509010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 44568325 - 44568370
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
44568325 |
aggctaaaatatggttttggtccctgcaaatataactcgttttggt |
44568370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 44958507 - 44958462
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
44958507 |
aggctaaaatatgattttggtccctacaaatatgtctcgttttggt |
44958462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 46304085 - 46304130
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
46304085 |
aggctaaaatatgattttagttcctgcaaatatgcctcgttttggt |
46304130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 48192260 - 48192301
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggt |
48192301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 1006835 - 1006879
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
1006879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 1974009 - 1974053
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggt |
1974053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 215
Target Start/End: Original strand, 6954862 - 6954902
Alignment:
| Q |
175 |
aaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggt |
6954902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 7431951 - 7431995
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
7431995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 17999465 - 17999509
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
17999509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 18022708 - 18022660
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
18022708 |
tataggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
18022660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 19561154 - 19561198
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
19561198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 20388266 - 20388318
Alignment:
| Q |
163 |
taaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
20388266 |
taaatttaggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
20388318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 24717532 - 24717488
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggt |
24717488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 212
Target Start/End: Original strand, 28911574 - 28911618
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| |||||||| |
|
|
| T |
28911574 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
28911618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 35469880 - 35469924
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggt |
35469924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 215
Target Start/End: Original strand, 37372441 - 37372481
Alignment:
| Q |
175 |
aaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggt |
37372481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 44403249 - 44403205
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggt |
44403205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 44508720 - 44508764
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
44508764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 45021864 - 45021812
Alignment:
| Q |
163 |
taaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||||| || |||||||||||| ||| ||||||| |
|
|
| T |
45021864 |
taaaaataggctaaaatatggttttagtccctgcaaatatgcctcattttggt |
45021812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 46829312 - 46829268
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggt |
46829268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 5355120 - 5355073
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| |||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5355120 |
ataggttaaagtatggttttggtccctgcaaatatgcctcgttttggt |
5355073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 18022368 - 18022411
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggt |
18022411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 31503780 - 31503741
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttg |
31503741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 37527421 - 37527378
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggt |
37527378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 38186369 - 38186408
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttg |
38186408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 38486476 - 38486519
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||| ||||||| |||| |||||||||||||||| |
|
|
| T |
38486476 |
taggctaaaatatgattttggtccctgtaaatatgtctcgtttt |
38486519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 39520727 - 39520688
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttg |
39520688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 39719644 - 39719601
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||| |
|
|
| T |
39719644 |
taggctaaaatatggttttagtccctgcaaatatggctcgtttt |
39719601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 41053841 - 41053884
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| ||||| |
|
|
| T |
41053841 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttg |
41053884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 41365213 - 41365170
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggt |
41365170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 214
Target Start/End: Original strand, 45021494 - 45021537
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttgg |
214 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgg |
45021537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 1559706 - 1559664
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||| |
|
|
| T |
1559706 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
1559664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 6509207 - 6509249
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||| |
|
|
| T |
6509207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
6509249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 203
Target Start/End: Complemental strand, 11767277 - 11767243
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatg |
203 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
11767277 |
taggctaaaatatggttttggtccctgcaaatatg |
11767243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 17854151 - 17854193
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggt |
17854193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 212
Target Start/End: Complemental strand, 18891562 - 18891524
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
18891524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 19005598 - 19005640
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttg |
19005640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 31310363 - 31310409
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||||||| |
|
|
| T |
31310363 |
taggctaaaatatgattttagtccctgcaaatatttctcgttttggt |
31310409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 31732101 - 31732143
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
31732143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 37159906 - 37159864
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| |||||||||| |
|
|
| T |
37159906 |
ctaaaatatgattttggtttctgcaaatatgtttcgttttggt |
37159864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 38186762 - 38186716
Alignment:
| Q |
170 |
aggctaaaatatggtttt-ggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
38186762 |
aggctaaaatatgatttttggtccctgcaaatatgtctcgttttggt |
38186716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 212
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgtttt |
44841673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 45073312 - 45073358
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||| | ||||||||||| |
|
|
| T |
45073312 |
taggctaaaatatggttttagtccctgcaaataagcctcgttttggt |
45073358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 212
Target Start/End: Original strand, 45228610 - 45228656
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
45228610 |
atataggctaaaatatggttttgggccccgcaaatatgcctcgtttt |
45228656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 2945846 - 2945801
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||||| ||||||||||| |
|
|
| T |
2945846 |
aggctaaaatatgtttttggtccctacaaatatgcctcgttttggt |
2945801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 5308323 - 5308364
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgtttt |
5308364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 172 - 213
Target Start/End: Original strand, 6079810 - 6079851
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
6079851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 6509471 - 6509426
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||| |||||||| ||||||||||| |
|
|
| T |
6509471 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggt |
6509426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 6589271 - 6589230
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggt |
6589230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 13770082 - 13770037
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| | ||||||||| |
|
|
| T |
13770082 |
aggctaaaatatggttttagtccctgcaaatatgccccgttttggt |
13770037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 16940761 - 16940806
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
16940761 |
aggctaacatatggttttggtccctgcaaatatgcctcggtttggt |
16940806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 16941049 - 16941008
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggt |
16941008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 21223749 - 21223704
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
21223749 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggt |
21223704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 21554756 - 21554711
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| || |||||| |
|
|
| T |
21554756 |
ataggctaaaatatggttttagtccctgcaaatatgccttgttttg |
21554711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 23817035 - 23816990
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
23817035 |
aggctaaaatatggttttagtctctgtaaatatgtctcgttttggt |
23816990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 30352563 - 30352604
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggt |
30352604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 31310680 - 31310635
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
31310680 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggt |
31310635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 184 - 213
Target Start/End: Complemental strand, 38486720 - 38486691
Alignment:
| Q |
184 |
ttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38486720 |
ttttggttcctgcaaatatgtctcgttttg |
38486691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 45073642 - 45073597
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||| ||||||||||| |
|
|
| T |
45073642 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggt |
45073597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 45671210 - 45671255
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||| |||||||||||||| || | ||||||||||||||||||| |
|
|
| T |
45671210 |
tataggttaaaatatggttttagtccatgcaaatatgtctcgtttt |
45671255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 46648716 - 46648671
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
46648716 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttggt |
46648671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 48854071 - 48854026
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||||| |||||||||| |
|
|
| T |
48854071 |
aggctaaaatatgattttgatccctgcaaatatgtttcgttttggt |
48854026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 10358368 - 10358324
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggt |
10358324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 18926883 - 18926931
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||| |||| | |||||||| ||||||||||| |
|
|
| T |
18926883 |
tatagactaaaatatggttttagttcattcaaatatgactcgttttggt |
18926931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 31732457 - 31732409
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||| |||||||||||||||||| || | |||||||||| ||||||||| |
|
|
| T |
31732457 |
aataaaggctaaaatatggttttagtccatgcaaatatgcctcgttttg |
31732409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 205
Target Start/End: Complemental strand, 36687269 - 36687229
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtc |
205 |
Q |
| |
|
|||| ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
36687269 |
aataaaggctaaaatatgattttggtccctgcaaatatgtc |
36687229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 46304384 - 46304340
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||| |||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggt |
46304340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 27371 - 27320
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27371 |
aaatttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
27320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 26998 - 27042
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
26998 |
taggctcaaatttggttttggtccctgcaaatatgtctcgttttg |
27042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 145)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 3512273 - 3512222
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3512273 |
aaatttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
3512222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 25600227 - 25600274
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25600227 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
25600274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 35097325 - 35097372
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35097325 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
35097372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 35347001 - 35346954
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35347001 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
35346954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 9496339 - 9496385
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9496339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
9496385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 10337117 - 10337163
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10337117 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
10337163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 13155253 - 13155207
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13155253 |
taggctaaaatatggtttttgttcctgcaaatatgtctcgttttggt |
13155207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 7420229 - 7420274
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7420229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
7420274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 8298976 - 8298931
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8298976 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
8298931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 11019519 - 11019564
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11019519 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
11019564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 29158349 - 29158398
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
29158349 |
atataggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
29158398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 32725906 - 32725951
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32725906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
32725951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 1778564 - 1778608
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
1778608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 7186004 - 7185960
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
7185960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 8298587 - 8298631
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
8298631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 14489073 - 14489029
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
14489029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 34963664 - 34963620
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
34963620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 35346629 - 35346673
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
35346673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 42132864 - 42132908
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
42132908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 42133154 - 42133110
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
42133110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 17073804 - 17073851
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
17073804 |
ataggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
17073851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 17574466 - 17574419
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
17574466 |
ataggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
17574419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 19494116 - 19494163
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
19494116 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
19494163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 4473702 - 4473748
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
4473702 |
taggctaaaatatggttttggtccctgcaaatacgtctcgttttggt |
4473748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 4710222 - 4710176
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4710222 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
4710176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 8094473 - 8094523
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
8094473 |
aatataggctaaaatatggttttagtctctgcaaatatgtctcgttttggt |
8094523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 11019859 - 11019813
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
11019859 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
11019813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 11976738 - 11976692
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11976738 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggt |
11976692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 20984516 - 20984466
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
20984516 |
aataaaggctaaaatatggttttggtccctacaaatatgtctcgttttggt |
20984466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 28346760 - 28346714
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28346760 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
28346714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 32726273 - 32726227
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
32726273 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
32726227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 35345619 - 35345573
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
35345619 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggt |
35345573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 40492958 - 40493004
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
40492958 |
taggctaaaatatggttttagtacctgcaaatatgtctcgttttggt |
40493004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 2728231 - 2728276
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
2728231 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggt |
2728276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 7272419 - 7272464
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
7272419 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
7272464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 11976372 - 11976417
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
11976372 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
11976417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 13232201 - 13232242
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggt |
13232242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 14238750 - 14238795
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
14238750 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
14238795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 16789074 - 16789119
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
16789074 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
16789119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 20984145 - 20984190
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
20984145 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggt |
20984190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 25131110 - 25131155
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
25131110 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
25131155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 28346393 - 28346438
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28346393 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
28346438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 34963299 - 34963344
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34963299 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
34963344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 37536085 - 37536130
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
37536085 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
37536130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 1526176 - 1526128
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
1526176 |
tataggctaaaatatggttttagtccctgcaaatatggctcgttttggt |
1526128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 2728597 - 2728553
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
2728553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 7326082 - 7326130
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
7326082 |
tataggctaaaatatggttttggtccttgcaaatatgcctcgttttggt |
7326130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 7326421 - 7326377
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
7326377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 25131447 - 25131403
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggt |
25131403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 27117751 - 27117795
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
27117751 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttg |
27117795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 35097692 - 35097648
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
35097648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 42430120 - 42430076
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
42430076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 5357420 - 5357467
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
5357420 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggt |
5357467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 9175005 - 9175056
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
9175005 |
aaataaaggctaaaatatgattttggtccttgcaaatatgtctcgttttggt |
9175056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 10337451 - 10337408
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
10337451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
10337408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 10872908 - 10872959
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
10872908 |
aaataaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
10872959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 15930933 - 15930976
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggt |
15930976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 18549576 - 18549529
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
18549576 |
atagactaaaatatggttttcgtccctgcaaatatgtctcgttttggt |
18549529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 22650463 - 22650506
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
22650463 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
22650506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 24090487 - 24090444
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
24090444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 25702811 - 25702768
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
25702811 |
taggctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 27117983 - 27117932
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
27117983 |
aaataaaggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
27117932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 36044791 - 36044748
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggt |
36044748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 3511904 - 3511950
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
3511904 |
taggctaaaatatggttttggtcccttcaaatatgcctcgttttggt |
3511950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 10776150 - 10776192
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
10776192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 13779151 - 13779193
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggt |
13779193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 161 - 215
Target Start/End: Original strand, 16643651 - 16643705
Alignment:
| Q |
161 |
gttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||| ||||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
16643651 |
gttaaatttaggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
16643705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 20277691 - 20277733
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
20277691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
20277733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 20278059 - 20278013
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
20278059 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggt |
20278013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 21064318 - 21064360
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
21064318 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
21064360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 21064686 - 21064640
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
21064686 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggt |
21064640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 24955012 - 24954966
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
24955012 |
taggctaaaatatggttttagtccctgcaaatatgactcgttttggt |
24954966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 1525808 - 1525853
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
1525808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
1525853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 2811778 - 2811737
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggt |
2811737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 4474045 - 4474000
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
4474045 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
4474000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 7420591 - 7420546
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
7420591 |
aggctaaaatatggttttggtcactgcaaatatgcctcgttttggt |
7420546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 9496724 - 9496679
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
9496724 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
9496679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 10540783 - 10540738
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
10540783 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
10540738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 14239081 - 14239036
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
14239081 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
14239036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 14495068 - 14495113
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
14495068 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
14495113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 14496815 - 14496860
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
14496815 |
aggctaaaatatggttttagttcctgcaaatatgcgtcgttttggt |
14496860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 16644045 - 16644000
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
16644045 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggt |
16644000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 18549196 - 18549245
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
18549196 |
atataggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
18549245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 19494414 - 19494369
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
19494369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 22917563 - 22917608
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
22917563 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
22917608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 23939547 - 23939588
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgtttt |
23939588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 24187898 - 24187853
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
24187898 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggt |
24187853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 24815069 - 24815024
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggt |
24815024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 25600598 - 25600553
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
25600598 |
aggctaaaatatagttttggtccctgcaaatatgtcttgttttggt |
25600553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 27341592 - 27341547
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
27341592 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
27341547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 28324182 - 28324137
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
28324182 |
aggctaaaatatggttttggtccctacaaatatgtcttgttttggt |
28324137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 30337218 - 30337173
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
30337218 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggt |
30337173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 32418317 - 32418362
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
32418317 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
32418362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 38930301 - 38930346
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
38930301 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggt |
38930346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 43477162 - 43477207
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
43477162 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
43477207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 44997924 - 44997973
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||| ||||||||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
44997924 |
aaataaaggctaaaatatgattttggtccctgcaaatatgcctcgttttg |
44997973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 4375692 - 4375736
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
4375736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 4621354 - 4621310
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggt |
4621310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 10776499 - 10776455
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
10776455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 10873280 - 10873236
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggt |
10873236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 13232562 - 13232518
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
13232518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 15719656 - 15719700
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggt |
15719700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 16789369 - 16789325
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
16789325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 23939907 - 23939867
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttgg |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
23939907 |
taaaatatggttttgattcctgcaaatatgactcgttttgg |
23939867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 37536419 - 37536375
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
37536375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 4016906 - 4016949
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
4016949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 13779531 - 13779488
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggt |
13779488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 24090118 - 24090161
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
24090118 |
aggctaaaatatggttttggttcttgtagatatgtctcgttttg |
24090161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 184 - 215
Target Start/End: Original strand, 24090192 - 24090223
Alignment:
| Q |
184 |
ttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24090192 |
ttttggttcctgcaaatatgtctcgttttggt |
24090223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 25702510 - 25702553
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| |||||||| |
|
|
| T |
25702510 |
taggctaaaatatggttttggtccctgtaaatatgcctcgtttt |
25702553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 33636319 - 33636366
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
33636319 |
ataggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
33636366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 2356250 - 2356204
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||| ||||| ||| |||||||||||||||||||||| |
|
|
| T |
2356250 |
taggttaaaatatgattttgattcatgcaaatatgtctcgttttggt |
2356204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 6469278 - 6469324
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| ||| || |||||||||||| ||||||||||| |
|
|
| T |
6469278 |
taggctaaaatatggctttcgtccctgcaaatatgcctcgttttggt |
6469324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 8094843 - 8094797
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
8094843 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggt |
8094797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 9175373 - 9175327
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
9175373 |
taggttaaaatatggttttggtccctgtaaatatgcctcgttttggt |
9175327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 10540447 - 10540493
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
10540447 |
taggctaaaatattgttttggtctctgcaaatatgcctcgttttggt |
10540493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 202
Target Start/End: Complemental strand, 10718514 - 10718476
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatat |
202 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
10718514 |
aaatataggctaaaatatgcttttggtccctgcaaatat |
10718476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 10755528 - 10755486
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
10755486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 28497254 - 28497296
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
28497254 |
aggctaaaatatgattttggtccctgcaaatatgcctcgtttt |
28497296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 33526414 - 33526368
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
33526414 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
33526368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 40066496 - 40066538
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||| |
|
|
| T |
40066496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
40066538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 43727431 - 43727390
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagt-cctgcaaatatgtctcgttttggt |
43727390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 1408005 - 1408046
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgtttt |
1408046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 1685117 - 1685158
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggt |
1685158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 3680802 - 3680757
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||| ||||||||||| |
|
|
| T |
3680802 |
aggctaaaatatgattttgatccctgcaaatatgcctcgttttggt |
3680757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 4017301 - 4017256
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
4017301 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggt |
4017256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 19962991 - 19963036
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||| || || | ||||||||||||||||||| |
|
|
| T |
19962991 |
tataggctaaaatatggtgttagtccttgcaaatatgtctcgtttt |
19963036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 21125718 - 21125763
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||| ||||||||||| |
|
|
| T |
21125718 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggt |
21125763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 28258246 - 28258197
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28258246 |
atataggctaaaatatggttttaacctctgcaaatatgtctcgttttggt |
28258197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 28497616 - 28497575
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggt |
28497575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 29488111 - 29488066
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
29488111 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggt |
29488066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 29992303 - 29992258
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||| ||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
29992303 |
ataggctcaaatatggttttgttccctgcaaatatgcctcgttttg |
29992258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 32195280 - 32195321
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| |||| |
|
|
| T |
32195280 |
ggctaaaatatggttttggtccctacaaatatgtctcatttt |
32195321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 38930665 - 38930620
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
38930665 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
38930620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 40844532 - 40844491
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || ||||||||||| |||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggt |
40844491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 215
Target Start/End: Complemental strand, 1778917 - 1778885
Alignment:
| Q |
183 |
gttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggt |
1778885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 7272751 - 7272707
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggt |
7272707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 13154882 - 13154930
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| |||||| | | |||||||||| ||||||||||| |
|
|
| T |
13154882 |
tataggctaaaatatagttttgatccttgcaaatatgcctcgttttggt |
13154930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 29158669 - 29158625
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggt |
29158625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 29487750 - 29487794
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| || ||||||||||||| |||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggt |
29487794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 203
Target Start/End: Complemental strand, 30969717 - 30969685
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatg |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatg |
30969685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 40066820 - 40066776
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| | ||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggt |
40066776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 40493157 - 40493113
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||| ||||||| || |||||||||||| ||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggt |
40493113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 40844156 - 40844200
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
40844200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 44998263 - 44998219
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | || |||||||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggt |
44998219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 116)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 10910967 - 10910920
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10910967 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
10910920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 6412216 - 6412262
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6412216 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
6412262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 8170153 - 8170107
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8170153 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
8170107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 22543720 - 22543674
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22543720 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
22543674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 3276355 - 3276310
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3276355 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
3276310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 3968644 - 3968689
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3968644 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
3968689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 12757609 - 12757654
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12757609 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
12757654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 17765008 - 17765053
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17765008 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
17765053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 19690392 - 19690437
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19690392 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
19690437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 21147395 - 21147448
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
21147395 |
ttaaatataggctaaaatatggttttggtccctgcaaatatgcatcgttttggt |
21147448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 21385250 - 21385295
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21385250 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
21385295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 25137362 - 25137313
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25137362 |
atataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
25137313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 22543350 - 22543398
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
22543350 |
tataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
22543398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 24901239 - 24901283
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
24901283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 1007512 - 1007465
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1007512 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
1007465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 3969012 - 3968965
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3969012 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
3968965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 20467721 - 20467674
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
20467721 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
20467674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 21993784 - 21993831
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
21993784 |
ataggctaaaatatggttttgctccctgcaaatatgtctcgttttggt |
21993831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 3414385 - 3414431
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3414385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
3414431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 18024377 - 18024331
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
18024377 |
taggctaaaatatggttttggtccctgcaaatatgtcttgttttggt |
18024331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 19321133 - 19321087
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19321133 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
19321087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 21994405 - 21994359
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
21994405 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
21994359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 25121498 - 25121452
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
25121498 |
taggctaaaatatggttttggtgcctgcaaatatgtttcgttttggt |
25121452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 25431856 - 25431810
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
25431856 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
25431810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 3414753 - 3414708
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
3414753 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggt |
3414708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 12299141 - 12299096
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
12299141 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
12299096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 14656261 - 14656216
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
14656261 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggt |
14656216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 23502236 - 23502281
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
23502236 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
23502281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 23502541 - 23502496
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
23502541 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
23502496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 30928680 - 30928725
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
30928680 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
30928725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 6564574 - 6564626
Alignment:
| Q |
164 |
aaatataggctaaaatatggtttt-ggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
6564574 |
aaatataggctaaattatggtttttggtccctgcaaatatgtctcgttttggt |
6564626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 24692981 - 24692937
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
24692981 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
24692937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 30239293 - 30239337
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggt |
30239337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 30479059 - 30479107
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||||||| |
|
|
| T |
30479059 |
tataggctaaaatatggttttggtccctgtaaatatgtcccgttttggt |
30479107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 31198615 - 31198659
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggt |
31198659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 494751 - 494708
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
494708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 6412580 - 6412537
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
6412580 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttg |
6412537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 19129329 - 19129380
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
19129329 |
aaatataggctacaatatggctttggtccctgcaaatatgcctcgttttggt |
19129380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 23770162 - 23770205
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
23770205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 30479421 - 30479378
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggt |
30479378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 317810 - 317856
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
317810 |
taggctaaaatatagttttagtccctgcaaatatgtctcgttttggt |
317856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 1007122 - 1007168
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
1007122 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
1007168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 1214998 - 1214952
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
1214998 |
taggctaaaatatggttttgatctctgcaaatatgtctcgttttggt |
1214952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 6564945 - 6564900
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
6564945 |
taggctaaaat-tggttttggtccctgcaaatatgtctcgttttggt |
6564900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 6591440 - 6591398
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggt |
6591398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 7156162 - 7156116
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
7156162 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
7156116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 12176645 - 12176599
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
12176645 |
taggttaaaatatggttttagtccctgcaaatatgtctcgttttggt |
12176599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 174 - 212
Target Start/End: Original strand, 12298825 - 12298863
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgtttt |
12298863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 13617531 - 13617573
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggt |
13617573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 17765376 - 17765334
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
17765376 |
aggctaaaatatgattttggtccctgcaaatatgtctcgtttt |
17765334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 19129522 - 19129476
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
19129522 |
taggctaaaatatgattttggtccctgcaaatatgtcacgttttggt |
19129476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 19320769 - 19320811
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggt |
19320811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 175 - 213
Target Start/End: Complemental strand, 19690755 - 19690717
Alignment:
| Q |
175 |
aaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgttttg |
19690717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 9896638 - 9896593
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
9896638 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggt |
9896593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 11448536 - 11448581
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
11448536 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggt |
11448581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 12419703 - 12419752
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
12419703 |
atataggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
12419752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 13268108 - 13268149
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttt |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
13268108 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttt |
13268149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 15076205 - 15076160
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
15076205 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
15076160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 19267913 - 19267868
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | ||||||| |
|
|
| T |
19267913 |
aggctaaaatatggttttggttcctgtaaatatgtcccattttggt |
19267868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 21385585 - 21385540
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
21385585 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
21385540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 24274132 - 24274087
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
24274132 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
24274087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 25136993 - 25137038
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
25136993 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggt |
25137038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 26375692 - 26375737
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
26375692 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggt |
26375737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 32885668 - 32885717
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
32885668 |
atataggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
32885717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 33801744 - 33801699
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
33801744 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
33801699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 318105 - 318053
Alignment:
| Q |
163 |
taaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
318105 |
taaaaataggctaaaatatggttttaatccctgcaaatatgtttcgttttggt |
318053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 494405 - 494449
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
494449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 1890454 - 1890410
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
1890454 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
1890410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 10910629 - 10910673
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggt |
10910673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 15722608 - 15722652
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15722608 |
taggctaaaatatggttttggtctatgcaaatatgtctcgttttg |
15722652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 15962389 - 15962345
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
15962345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 19296407 - 19296363
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
19296363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 23629101 - 23629061
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
23629101 |
gctaaaatatggttttggttcctacaaatatgtctcatttt |
23629061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 34582529 - 34582573
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
34582573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 8680772 - 8680819
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
8680772 |
ataggctaaaatatgtttttagtccctgcaaatatgcctcgttttggt |
8680819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 11926036 - 11925989
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
11926036 |
ataggctaaaatatggttttggtctctgaaaatatgtcgcgttttggt |
11925989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 12419941 - 12419894
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
12419941 |
ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
12419894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 22822652 - 22822609
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
22822652 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
22822609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 23628799 - 23628842
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggt |
23628842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 23770441 - 23770398
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||| |
|
|
| T |
23770441 |
taggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 25121181 - 25121227
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
25121181 |
ataggctaaaatatggttttcat-cctgcaaatatgtctcgttttggt |
25121227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 31166871 - 31166914
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
31166914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 2615870 - 2615916
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
2615870 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggt |
2615916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 11925739 - 11925781
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctcgttttg |
11925781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 13268469 - 13268419
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||| ||| |||||||||| ||||||||| ||||||||||||||| ||||| |
|
|
| T |
13268469 |
ttaattattggctaaaataaggttttggtccctgcaaatatgtctggtttt |
13268419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 14655377 - 14655423
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
14655377 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
14655423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 15442937 - 15442979
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttg |
15442979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 15962025 - 15962071
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
15962025 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggt |
15962071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 31167200 - 31167158
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttg |
31167158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 34582894 - 34582848
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
34582894 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggt |
34582848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 777676 - 777721
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
777676 |
aggctaaaatatgattttagttcctgcaaatatacctcgttttggt |
777721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 1214695 - 1214740
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| | ||||||| |
|
|
| T |
1214695 |
aggctaaaatattgttttggtccctgcaaatatgtcgcattttggt |
1214740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 2373178 - 2373223
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
2373178 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
2373223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 2616241 - 2616196
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
2616241 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
2616196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 3356141 - 3356186
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
3356141 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggt |
3356186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 3356495 - 3356454
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggt |
3356454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 6591114 - 6591159
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || || ||||||||| ||||||||||| |
|
|
| T |
6591114 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggt |
6591159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 7155796 - 7155841
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||| ||||||||||| |
|
|
| T |
7155796 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggt |
7155841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 8681117 - 8681072
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
8681117 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
8681072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 10091039 - 10091080
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggt |
10091080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 11449170 - 11449125
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
11449170 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggt |
11449125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 20467354 - 20467395
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggt |
20467395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 21995063 - 21995108
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||| ||||||||||| |
|
|
| T |
21995063 |
aggctaaaatatggttttagtccctgcatatatgcctcgttttggt |
21995108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 22792900 - 22792855
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| | || |||||||||||| ||||||||||| |
|
|
| T |
22792900 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggt |
22792855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 24273827 - 24273872
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
24273827 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggt |
24273872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 26376042 - 26376001
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggt |
26376001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 31186591 - 31186550
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttt |
31186550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 31276339 - 31276298
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttg |
31276298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 31398542 - 31398497
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||| ||||||| |
|
|
| T |
31398542 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggt |
31398497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 215
Target Start/End: Original strand, 543365 - 543405
Alignment:
| Q |
175 |
aaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggt |
543405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 8169781 - 8169829
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| ||||||| | ||||||||||| | |||||| |
|
|
| T |
8169781 |
aatataggctaaaatatgattttggtccatgcaaatatgttttgttttg |
8169829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 14655903 - 14655947
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggt |
14655947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 17771911 - 17771955
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
17771955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 19267565 - 19267609
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggt |
19267609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 27765173 - 27765137
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgtt |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
27765173 |
taaaatatggttttggtccctgcaaatatatctcgtt |
27765137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 30929044 - 30929000
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
30929000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 169)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 33000676 - 33000625
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33000676 |
aaataaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
33000625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 39747838 - 39747791
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39747838 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
39747791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 8140432 - 8140478
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8140432 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
8140478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 10887600 - 10887554
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10887600 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
10887554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 45380270 - 45380316
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45380270 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
45380316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 45638896 - 45638850
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45638896 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
45638850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 3247197 - 3247242
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3247197 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
3247242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 12360969 - 12360924
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12360969 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
12360924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 15526363 - 15526318
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15526363 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
15526318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 19720711 - 19720756
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19720711 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
19720756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 24654168 - 24654123
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24654168 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
24654123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 30322928 - 30322973
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30322928 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
30322973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 36912850 - 36912895
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36912850 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 42482970 - 42483023
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
42482970 |
ttaaaaataggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
42483023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 10631164 - 10631208
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
10631208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 12322970 - 12322926
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
12322926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 24977778 - 24977822
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
24977822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 35056530 - 35056574
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
35056574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 40718110 - 40718154
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
40718154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 41358666 - 41358619
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
41358666 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
41358619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 45290450 - 45290501
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| |||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
45290450 |
aaataaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
45290501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 47819229 - 47819276
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
47819229 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
47819276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 49073684 - 49073735
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
49073684 |
aaataaaggctaaaatatggttttggtccttgcaaatatgtctcgttttggt |
49073735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 4789310 - 4789352
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
4789352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 10887231 - 10887277
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
10887231 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttggt |
10887277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 13260323 - 13260277
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
13260323 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
13260277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 17130081 - 17130039
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
17130039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 19622653 - 19622699
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
19622653 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
19622699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 21391094 - 21391140
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
21391094 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
21391140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 32035797 - 32035747
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
32035797 |
ttaaaaataggctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 48609596 - 48609550
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
48609596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
48609550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 6567497 - 6567452
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
6567497 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
6567452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 8140800 - 8140755
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
8140800 |
aggctaaaatatggttttggtacctgcaaatatgcctcgttttggt |
8140755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 10631529 - 10631484
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
10631529 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggt |
10631484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 13770484 - 13770533
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
13770484 |
atataggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
13770533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 14007488 - 14007533
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
14007533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 15211510 - 15211555
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
15211510 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggt |
15211555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 24507844 - 24507799
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24507844 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
24507799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 32626528 - 32626573
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
32626528 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
32626573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 33045691 - 33045646
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33045691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
33045646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 35056899 - 35056850
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
35056899 |
atataggctaaaatatgattttggtccctgcaaatatgcctcgttttggt |
35056850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 38150851 - 38150892
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggt |
38150892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 38164296 - 38164251
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
38164296 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
38164251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 47819597 - 47819552
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
47819597 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
47819552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 212
Target Start/End: Complemental strand, 4565339 - 4565295
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
4565339 |
ataggctaaaatatggttctggtccctgcaaatatgtctcgtttt |
4565295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 11822367 - 11822323
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
11822367 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
11822323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 22919680 - 22919728
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
22919680 |
tataggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
22919728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 22953556 - 22953512
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
22953512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 24653802 - 24653846
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
24653846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 25658014 - 25658058
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggt |
25658058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 26191734 - 26191690
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
26191690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 26324581 - 26324629
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
26324581 |
tataggctaaaatatgattttggtccctgcaaatatgcctcgttttggt |
26324629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 26442563 - 26442607
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
26442607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 31060787 - 31060831
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggt |
31060831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 38151212 - 38151168
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
38151168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 15058419 - 15058462
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggt |
15058462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 16026941 - 16026894
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
16026941 |
ataggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
16026894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 18473269 - 18473316
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
18473269 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
18473316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 22674200 - 22674247
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
22674200 |
ataggctaaaatatggtttaggtccatgcaaatatgtctcgttttggt |
22674247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 32420099 - 32420142
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggt |
32420142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 39025112 - 39025151
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttg |
39025151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 44157696 - 44157739
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
44157739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 990381 - 990335
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
990381 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
990335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 3247564 - 3247518
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3247564 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttggt |
3247518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 8364918 - 8364872
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
8364918 |
taggctaaaatatagttttggtccccgcaaatatgtctcgttttggt |
8364872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 15516580 - 15516626
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
15516580 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggt |
15516626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 17129691 - 17129733
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggt |
17129733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 21383098 - 21383148
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||| || ||||| |||||||||||||||||| |
|
|
| T |
21383098 |
aatataggctaaaatatgattttagtccctgctaatatgtctcgttttggt |
21383148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 26207280 - 26207322
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggt |
26207322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 30323295 - 30323249
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
30323295 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggt |
30323249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 33000305 - 33000347
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttg |
33000347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 33067346 - 33067392
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
33067346 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggt |
33067392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 35005746 - 35005700
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
35005746 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
35005700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 1810926 - 1810971
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
1810926 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
1810971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 7867358 - 7867313
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
7867358 |
aggctaaaatatggttttggtccctgcaaatatgtcttattttggt |
7867313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 11822003 - 11822048
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
11822003 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
11822048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 15058767 - 15058722
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
15058767 |
aggctaaaatattgttttgatccctgcaaatatgtctcgttttggt |
15058722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 18302388 - 18302343
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
18302343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 18473596 - 18473551
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
18473596 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
18473551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 18899842 - 18899883
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggt |
18899883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 26061955 - 26062000
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
26061955 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
26062000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 213
Target Start/End: Original strand, 27521577 - 27521618
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
27521618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 29072496 - 29072541
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
29072496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
29072541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 31061152 - 31061107
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
31061152 |
aggctaaaatatggttttgatccctgcaaatatatctcgttttggt |
31061107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 32454296 - 32454251
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttgg |
214 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
32454296 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgg |
32454251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 32729050 - 32729005
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
32729050 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
32729005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 33234545 - 33234590
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
33234545 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
33234590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 33379887 - 33379932
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
33379887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
33379932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 34002634 - 34002679
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
34002634 |
aggctaaagtatgattttggtccctgcaaatatgtctcgttttggt |
34002679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 34002941 - 34002896
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
34002941 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggt |
34002896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 35307714 - 35307759
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
35307714 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
35307759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 38163934 - 38163975
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggt |
38163975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 39747473 - 39747517
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
39747473 |
aggctaaaatatggttttgg-tcctgcaaatacgtctcgttttggt |
39747517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 41358368 - 41358413
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
41358413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 41881092 - 41881137
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
41881092 |
aggctaaaatatggttttagtccctccaaatatgtctcgttttggt |
41881137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 45368489 - 45368534
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
45368489 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
45368534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 48609235 - 48609280
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
48609235 |
aggctaaaatatggttttagtcccggcaaatatgtctcgttttggt |
48609280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 210
Target Start/End: Complemental strand, 4360627 - 4360587
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtt |
210 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
4360627 |
aggctaaaatatggttttagtccctgcaaatatgtctcgtt |
4360587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 7001897 - 7001853
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
7001853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 212
Target Start/End: Original strand, 12360600 - 12360644
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
12360600 |
ataggctaaaatatggttttggtccctgcaaatatgcctcatttt |
12360644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 15211858 - 15211814
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggt |
15211814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 16060885 - 16060841
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggt |
16060841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 211
Target Start/End: Original strand, 20948755 - 20948795
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttt |
211 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgttt |
20948795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 24507479 - 24507523
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
24507523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 24649350 - 24649394
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
24649394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 212
Target Start/End: Complemental strand, 28507461 - 28507417
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
28507461 |
ataggctaaaatattgttttggtccctgcaaatatgtctcatttt |
28507417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 34808193 - 34808241
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||| |||||||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
34808193 |
tataggttaaaatatggttttagtcccttcaaatatgtctcgttttggt |
34808241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 35308111 - 35308067
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
35308067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 38136981 - 38136937
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggt |
38136937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 45380636 - 45380592
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggt |
45380592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 45638580 - 45638624
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
45638624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 46868577 - 46868533
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggt |
46868533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 3753214 - 3753257
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
3753257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 7867127 - 7867170
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||| || | ||||||||||||||||||| |
|
|
| T |
7867127 |
taggctaaaatatggttttagtccttgcaaatatgtctcgtttt |
7867170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 18079661 - 18079618
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
18079661 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 35005443 - 35005486
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
35005443 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
35005486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 39303675 - 39303718
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggt |
39303718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 44641079 - 44641122
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
44641122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 184 - 215
Target Start/End: Complemental strand, 49923748 - 49923717
Alignment:
| Q |
184 |
ttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49923748 |
ttttggttcctgcaaatatgtctcgttttggt |
49923717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 50428872 - 50428915
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttg |
50428915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 52254176 - 52254227
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| |||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
52254176 |
aaataaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
52254227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 4617397 - 4617351
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
4617397 |
taggctaaaatatgattttggttccaacaaatatgtttcgttttggt |
4617351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 12322604 - 12322646
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| |||||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttg |
12322646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 13259986 - 13260032
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
13259986 |
taggctaaaatatggttttagtcgctgcaaatatggctcgttttggt |
13260032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 16083046 - 16083088
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
16083046 |
aggctaaaatatggttttagtccccgcaaatatgtctcgtttt |
16083088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 212
Target Start/End: Original strand, 31404429 - 31404467
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
31404429 |
taaaatatgattttggtccctgcaaatatgtctcgtttt |
31404467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 33045353 - 33045399
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| || |||||||| |
|
|
| T |
33045353 |
taggctaaaatttggttttggtccctgcaaatatgcctagttttggt |
33045399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 33234912 - 33234870
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttg |
33234870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 45290822 - 45290776
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || || ||||||||| ||||||||||| |
|
|
| T |
45290822 |
taggctaaaatatggttttagtccccgcaaatatgcctcgttttggt |
45290776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 46183686 - 46183728
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggt |
46183728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 48955712 - 48955758
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
48955712 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
48955758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 50429211 - 50429165
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
50429211 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
50429165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 50799128 - 50799174
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||| ||||||| |
|
|
| T |
50799128 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggt |
50799174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 52254479 - 52254437
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
52254437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 990087 - 990132
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||| |||||||| ||||||||||| |
|
|
| T |
990087 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggt |
990132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 3679625 - 3679670
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||| |||||||| ||||||||||| |
|
|
| T |
3679625 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggt |
3679670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 3753573 - 3753528
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||| ||||||||||| |
|
|
| T |
3753573 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggt |
3753528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 172 - 213
Target Start/End: Original strand, 4323829 - 4323870
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
4323870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 4324163 - 4324122
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
4324163 |
taaaatatgattttagttcatgcaaatatgtctcgttttggt |
4324122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 7350426 - 7350467
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggt |
7350467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 8364619 - 8364660
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggt |
8364660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 12361010 - 12361055
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||| || ||||||||||| |
|
|
| T |
12361010 |
aggctaaaatatggttttagtccctgcaaatttgcctcgttttggt |
12361055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 16060595 - 16060639
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
16060595 |
aggctaaaatatggttttggtccct-caaatatgcctcgttttggt |
16060639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 17984332 - 17984377
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
17984332 |
aggctaaaatatggtttgagtccctgcaaatatgcctcgttttggt |
17984377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 18900130 - 18900089
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggt |
18900089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 19623018 - 19622973
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
19623018 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
19622973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 19721071 - 19721030
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggt |
19721030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 24510308 - 24510267
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgtttt |
24510267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 26442900 - 26442855
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
26442900 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggt |
26442855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 29688429 - 29688384
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
29688429 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
29688384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 31258338 - 31258383
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||| ||||||||||| |
|
|
| T |
31258338 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggt |
31258383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 210
Target Start/End: Complemental strand, 31404724 - 31404683
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgtt |
210 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| |||||||||| |
|
|
| T |
31404724 |
taggctaaaatatggttttggtccctacaaacatgtctcgtt |
31404683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 32906243 - 32906198
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||| ||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
32906243 |
ataggttaaaatatgattttggtccttgcaaatatgtctcgttttg |
32906198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 37624745 - 37624790
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||| | || |||||||||||| ||||||||||| |
|
|
| T |
37624745 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggt |
37624790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 41738796 - 41738837
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcatttt |
41738837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 203
Target Start/End: Complemental strand, 42483272 - 42483239
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatg |
203 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
42483272 |
aggctaaaatatggttttggtccctgcaaatatg |
42483239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 44158043 - 44157998
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
44158043 |
aggctaaaatatggtttttgtccctgcaaatatgcctagttttggt |
44157998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 48956071 - 48956022
Alignment:
| Q |
166 |
atataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
48956071 |
atattggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
48956022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 212
Target Start/End: Original strand, 4617085 - 4617129
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||| ||||||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
4617085 |
ataggttaaaatatggttttggtccctgaaaatatgtttcgtttt |
4617129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 5058998 - 5058950
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||| ||| ||||||||||||||||| |||| ||||||| ||||||||| |
|
|
| T |
5058998 |
aataaaggttaaaatatggttttggtccctggaaatatgcctcgttttg |
5058950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 17984701 - 17984657
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
17984657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 18928141 - 18928101
Alignment:
| Q |
172 |
gctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcatttt |
18928101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 26191359 - 26191403
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggt |
26191403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 29072862 - 29072818
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||| |||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggt |
29072818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 30962412 - 30962460
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
30962412 |
tataggctaaaatatggcattggtccctgcaaatatgtccagttttggt |
30962460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 37545628 - 37545672
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggt |
37545672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 39025381 - 39025338
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggt |
39025338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 203
Target Start/End: Complemental strand, 40718474 - 40718442
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatg |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatg |
40718442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 44641432 - 44641388
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
44641388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 47919 - 47969
Alignment:
| Q |
165 |
aatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47919 |
aataaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
47969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 207
Target Start/End: Complemental strand, 223174 - 223136
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctc |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
223174 |
taggctaaaatatggttttggtccctgcaaatatgtctc |
223136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 48228 - 48187
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggt |
48187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 82715 - 82662
Alignment:
| Q |
162 |
ttaaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
82715 |
ttaaaaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
82662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 82340 - 82385
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
82340 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggt |
82385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 148282 - 148238
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
148238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 75771 - 75720
Alignment:
| Q |
164 |
aaatataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
75771 |
aaatttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggt |
75720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 75357 - 75403
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
75357 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttggt |
75403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 4039 - 4085
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
4039 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
4085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 19221 - 19267
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
19221 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
19267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 4289 - 4244
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4289 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggt |
4244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 19471 - 19426
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
19471 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggt |
19426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 2883 - 2841
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
2841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 2498 - 2543
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |||||||| |
|
|
| T |
2498 |
ataggctaaaatatggttttgatccctgcaaatatgcttcgttttg |
2543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 1310 - 1355
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
1310 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
1355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 290 - 245
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
290 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 212
Target Start/End: Complemental strand, 4083 - 4038
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
4083 |
tataggctaaaatacggttttggtccctgcaaatatgtctcgtttt |
4038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 203
Target Start/End: Original strand, 3749 - 3784
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatg |
203 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3749 |
ataggctaaaatatggttttggtccctgcaaatatg |
3784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 50075 - 50034
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggt |
50034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 55176 - 55135
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggt |
55135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 54814 - 54859
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||||||||| |
|
|
| T |
54814 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggt |
54859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 3455 - 3411
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggt |
3411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 12525 - 12569
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
12569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 3532 - 3576
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
3576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 3919 - 3874
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
3919 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggt |
3874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 10519 - 10471
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
10519 |
tataggctaaaatatggttttagtccctgcaaatatgtctggttttggt |
10471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 10168 - 10212
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
10212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 24369 - 24416
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
24369 |
ataggctaaaatatggttttagtcactgcaaatatgtctcgttttggt |
24416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 8329 - 8372
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
8329 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
8372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 8643 - 8600
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
8643 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
8600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 2662 - 2616
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
2662 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggt |
2616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 14695 - 14741
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
14695 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
14741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 15013 - 14968
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggt |
14968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 3293 - 3247
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
3293 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggt |
3247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 2777 - 2822
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
2777 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
2822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 5208 - 5253
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
5208 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
5253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 5228 - 5273
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
5228 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
5273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 5709 - 5664
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
5709 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggt |
5664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 5398 - 5443
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| || |||||||| |
|
|
| T |
5398 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggt |
5443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 366274 - 366229
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
366274 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
366229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 9028 - 8984
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
8984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 8734 - 8776
Alignment:
| Q |
173 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
8776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 4312 - 4268
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
4268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 16724 - 16768
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggt |
16768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 189325 - 189373
Alignment:
| Q |
167 |
tataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||| |||||| |||||| ||||||| ||||||||||| |
|
|
| T |
189325 |
tataggctaaaatatagttttgattcctgtaaatatgcctcgttttggt |
189373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 94054 - 94101
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| || ||| |||||||| ||||||||||| |
|
|
| T |
94054 |
ataggctaaaatatggttttagtccctacaaatatgcctcgttttggt |
94101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 202
Target Start/End: Complemental strand, 30969 - 30935
Alignment:
| Q |
168 |
ataggctaaaatatggttttggttcctgcaaatat |
202 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30969 |
ataggctaaaatatggttttggtccctgcaaatat |
30935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 35086 - 35040
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||||||||| | | | |||||||||||||||||||| |
|
|
| T |
35086 |
taggctaaaatatggttttgatccgtacaaatatgtctcgttttggt |
35040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 5067 - 5026
Alignment:
| Q |
174 |
taaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
5067 |
taaaatatggttttggtctctgcaaatatatctcgttttggt |
5026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 7265 - 7220
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
7265 |
aggctaaaatatgattttggtctctgcaaatatgtcttgttttggt |
7220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 8546 - 8591
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
8546 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
8591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 21695 - 21739
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
21695 |
aggctaaaatatggttttgatccctgcaaatatgt-tcgttttggt |
21739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 22056 - 22011
Alignment:
| Q |
170 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| || ||||||||||| |
|
|
| T |
22056 |
aggctaaaatatggttttggtcccttcaaatttgcctcgttttggt |
22011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 18045 - 18000
Alignment:
| Q |
169 |
taggctaaaatatggttttggttcctgcaaatatgtctcgttttgg |
214 |
Q |
| |
|
||||||||||||||||||| || ||||| |||||| |||||||||| |
|
|
| T |
18045 |
taggctaaaatatggttttagtccctgcgaatatgcctcgttttgg |
18000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 12182 - 12223
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgtttt |
212 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
12223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 12536 - 12492
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
12492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 34931 - 34975
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggt |
215 |
Q |
| |
|
|||||||||||||| || || |||||||||||| ||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggt |
34975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 211
Target Start/End: Complemental strand, 17966 - 17926
Alignment:
| Q |
171 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttt |
211 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttt |
17926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University