View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1632_low_55 (Length: 252)
Name: NF1632_low_55
Description: NF1632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1632_low_55 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 25 - 252
Target Start/End: Original strand, 45070261 - 45070496
Alignment:
| Q |
25 |
atgaagcaagccagcctgacagggacacccatgtatccaccaacaaagccttcaaacttatttggttacttgtgnnnnnnnn--------gcgaatttgt |
116 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45070261 |
atgaagcaagccagcctgacagtgccacccatgtatccaccaacaaagccttcaaacttatttggttacttgtgttttttttttttttttgcgaatttgt |
45070360 |
T |
|
| Q |
117 |
ctgaattcttgccctaagatgtttttatttttaatattgtctctcaatatagttcgtgtcgagtcccccgacagccaaagttcgtaccacctaggttgcg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45070361 |
ctgaattcttgccctaagatgtttttatttttaatattggctctcaatatagttcgtgtcgagtcccccgacagccaaagttcgtaccacctaggttgca |
45070460 |
T |
|
| Q |
217 |
cgtacctagcaatgtgtattcttggattttaagtct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45070461 |
cgtacctagcaatgtgtattcttggattttaagtct |
45070496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University