View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1632_low_63 (Length: 236)
Name: NF1632_low_63
Description: NF1632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1632_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 28740062 - 28739863
Alignment:
| Q |
20 |
ttttaattatcctaacatcaactccttgaaaaattgcaacattttatattcagttccaaattaaattttaataaatattttgtctcctatgtttccaccg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28740062 |
ttttaattatcctaacatcaactccttgaaaaattgcgacattttatcttcggttccaaattaaattttaataaatattttgtct---atgtttccaccg |
28739966 |
T |
 |
| Q |
120 |
ttagcaagattggtttccacataagtatgaagtggaggcgcaacagggtgccacatggccacattaaattacatggactccccatgtcattaacatttat |
219 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
28739965 |
ttagcaagattggtctccacataagtatgaagtggaggcgcaacggggtgccacatggccacattaaattacatgggctccacatgtcattaacatttat |
28739866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University