View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1632_low_66 (Length: 227)

Name: NF1632_low_66
Description: NF1632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1632_low_66
NF1632_low_66
[»] chr6 (1 HSPs)
chr6 (1-83)||(14041550-14041627)


Alignment Details
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 14041550 - 14041627
Alignment:
1 ataaatatttctctccatgacgacgatgatgatcatataataatgaaatttataacgagggtaatcttcaaagaatggttgtt 83  Q
    |||||||||| |||| |||||||||||||||||     ||||||  |||||||||||||||||||||||||||||||||||||    
14041550 ataaatatttttctcaatgacgacgatgatgat-----aataattgaatttataacgagggtaatcttcaaagaatggttgtt 14041627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University