View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1632_low_67 (Length: 221)
Name: NF1632_low_67
Description: NF1632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1632_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 39520752 - 39520566
Alignment:
| Q |
17 |
caaaggcctgttgagaattccaaatggttgcccattccagctgccagaggagggagttctcacggcagattaactgatgcaacatccattcaaggctcac |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||||| |
|
|
| T |
39520752 |
caaaggcctgttgagaattccgaatggttgcccattccagctgccagaggagggagttctcacagcagattaactgatgcaacaacaattcaaggctcac |
39520653 |
T |
 |
| Q |
117 |
ctttacctaacataaatcttggattgaaaatccccttgcttgatcttcaatttgcaactgataatttcaatgtgaagaggataattg |
203 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||| |||||||| |||| |
|
|
| T |
39520652 |
ctttacctaacataaaccttggattgaaaatccctttgcttgatcttcaatttgcaacggataatttcgatgcaaagaggattattg |
39520566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 39510494 - 39510308
Alignment:
| Q |
17 |
caaaggcctgttgagaattccaaatggttgcccattccagctgccagaggagggagttctcacggcagattaactgatgcaacatccattcaaggctcac |
116 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||| | |
|
|
| T |
39510494 |
caaaggcctgttgaaaattccgaatggttgccaattccagctgccagaggagggagttctcacagcagattaactgatgcaacagcaattcaaggctccc |
39510395 |
T |
 |
| Q |
117 |
ctttacctaacataaatcttggattgaaaatccccttgcttgatcttcaatttgcaactgataatttcaatgtgaagaggataattg |
203 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| ||||| || ||| ||||||||||||| |
|
|
| T |
39510394 |
ctttacctaacataaacctcggattgaaaatccccttgcttgatcttcaattcgcaacggataactttgatgcaaagaggataattg |
39510308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 17 - 162
Target Start/End: Complemental strand, 39524237 - 39524092
Alignment:
| Q |
17 |
caaaggcctgttgagaattccaaatggttgcccattccagctgccagaggagggagttctcacggcagattaactgatgcaacatccattcaaggctcac |
116 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||||||| | ||||||||||| | |
|
|
| T |
39524237 |
caaaggcctgttgagaagtccgaatggttgcctattccagctgccagaggaggaagttctcacagcagattaactgatgcaacaacaattcaaggctcgc |
39524138 |
T |
 |
| Q |
117 |
ctttacctaacataaatcttggattgaaaatccccttgcttgatct |
162 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
39524137 |
ctttacctaacataaaccttggattgaaaatccctttgcttgatct |
39524092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 17 - 166
Target Start/End: Complemental strand, 39575391 - 39575242
Alignment:
| Q |
17 |
caaaggcctgttgagaattccaaatggttgcccattccagctgccagaggagggagttctcacggcagattaactgatgcaacatccattcaaggctcac |
116 |
Q |
| |
|
|||||||||||||||| || | | | |||||| |||||| |||| |||||||| |||||| ||| ||||||| ||| || | | | ||||||||||| |
|
|
| T |
39575391 |
caaaggcctgttgagagtttcgatttgttgccgattccaactgctgcaggagggatttctcatagcaaattaacttatggaaaaacaactcaaggctcac |
39575292 |
T |
 |
| Q |
117 |
ctttacctaacataaatcttggattgaaaatccccttgcttgatcttcaa |
166 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||||| |||||| |
|
|
| T |
39575291 |
ctttacctaacataaaccttggcatgaaaatctccttgcttgaccttcaa |
39575242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 106 - 183
Target Start/End: Complemental strand, 39579838 - 39579761
Alignment:
| Q |
106 |
tcaaggctcacctttacctaacataaatcttggattgaaaatccccttgcttgatcttcaatttgcaactgataattt |
183 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||||| ||||| || ||||| |
|
|
| T |
39579838 |
tcaaggctcgcctttacctaacataaaccttggcctgaaaatctccttgcttgatcttcaattcgcaacagagaattt |
39579761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 106 - 166
Target Start/End: Complemental strand, 39543467 - 39543407
Alignment:
| Q |
106 |
tcaaggctcacctttacctaacataaatcttggattgaaaatccccttgcttgatcttcaa |
166 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||| |||||||||| |||||| |
|
|
| T |
39543467 |
tcaaggctcacctttacctaacataaaccttggcatgaaaatctccttgcttgaccttcaa |
39543407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University