View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16332_low_2 (Length: 450)
Name: NF16332_low_2
Description: NF16332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16332_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 387; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 15 - 438
Target Start/End: Original strand, 40865621 - 40866052
Alignment:
| Q |
15 |
aagttgcactttgtttttcccgttgtcacaattcatgcattgccatgtctttgtcgtctcttccctttgtggtgatcgctctcccaccaaagggggttta |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40865621 |
aagttgcactttgttttttccgttgtcacaattcatgcattgccatgtctttgtcgtctcttccctttgtggtggtcgctctcccaccaaagggggttta |
40865720 |
T |
|
| Q |
115 |
atgcttagacctcgaccaccatcactacccacattacaaccgcttcatcaccc--------acatccaaccctaattaagtcactgctccacctagttct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40865721 |
atgcttagacctcgaccaccatcactacccacattacaaccgcttcatcacccaccaacccacatccaaccctaattaagtcactgctccacctagttct |
40865820 |
T |
|
| Q |
207 |
ttcgtaggcaatcaccgtgtccaatatttcatgtgttccatgtgccaacctcattattacaagtccctccccgattgatcgatcccccacttcataaacc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40865821 |
ttcgtaggcaatcaccgtgtccaatatttcatgtgttccatgtgccaacctcattattacaagtctctccccgattgatcgatcccccacttcataaacc |
40865920 |
T |
|
| Q |
307 |
ttctttagatctgacttctatgactgcaacttcaattgaaaaaagaaccttcaaactccctcctaaagccacagtagaattagagttgagaacattctgg |
406 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40865921 |
ttctttagatttgacttctatgactgcaacttcaattgaaaaaagaaccttcaaactccctcctaaagccacagtagaattagagttgagaacattctgg |
40866020 |
T |
|
| Q |
407 |
tttgagatttaataattgtgttggggtatttt |
438 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40866021 |
tttgagatttaataattgtgttggggtatttt |
40866052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 28196885 - 28196837
Alignment:
| Q |
312 |
tagatctgacttctatgactgcaacttcaattgaaaaaagaaccttcaa |
360 |
Q |
| |
|
||||| |||||||||||| ||||||||| |||||||||| ||||||||| |
|
|
| T |
28196885 |
tagatttgacttctatgattgcaacttcgattgaaaaaataaccttcaa |
28196837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University