View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16333_high_7 (Length: 320)
Name: NF16333_high_7
Description: NF16333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16333_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 37352976 - 37353285
Alignment:
| Q |
1 |
catcatcatcttctagtaaaggaagttggggtaagaaaatgacgggaaaacctatgaatggtgttgggaagagacgtgttccaccttctccacatgagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37352976 |
catcatcatcttctagtaaaggaagttggggtaagaaaatgacgggaaaacctatgaatggtgttgggaagagacgtgttccaccttctccacatgagtt |
37353075 |
T |
|
| Q |
101 |
acactataaagcaaatagggctcaagctgaagagttgaggagaaagacgtttttgccttatagacaaggtctgcttggttgtttgggatttagttctaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37353076 |
acactataaagcaaatagggctcaagctgaagagttgaggagaaagacgtttttgccttatagacaaggtctgcttggttgtttgggatttagttctaag |
37353175 |
T |
|
| Q |
201 |
ggttatggggctatgaatggctttgctagagccttaaaccctgtttcttcaaggtaaattaatcccatacttgaggattggttggttttcttcaaattgt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
37353176 |
ggttatggggctatgaatggctttgctagagccttaaaccctgtttcttcaaggtaaattaatcccatactcgagggttggttggttttcttcaaattgt |
37353275 |
T |
|
| Q |
301 |
acagatcatt |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
37353276 |
acagatcatt |
37353285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University