View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16333_low_4 (Length: 208)
Name: NF16333_low_4
Description: NF16333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16333_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 1734749 - 1734550
Alignment:
| Q |
1 |
taggtatgaggatgatcgcaaagaaaggaagaactcaagggaagaggatgatcgcaaagtaagaaggaactcaagggaagatgatgatcacagagagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1734749 |
taggtatgaggatgatcgcaaagaaaggaagaactcaagggaagaggatgatcgcaaagtaagaaggaactcaagggaagatgatgatcacagagagaga |
1734650 |
T |
|
| Q |
101 |
aagagctcaagggatgaggatgttcgtggggaaagaaagtacagaggggacgatgattatcatggagagagaaagcgcagcagaagggatgatgatgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1734649 |
aagagctcaagggatgaggatgttcgtggggaaagaaagtacagaggggacgatgattatcatggagagagaaagcgcagcagaagggatgatgatgatg |
1734550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 114
Target Start/End: Complemental strand, 1734757 - 1734672
Alignment:
| Q |
29 |
aagaactcaagggaagaggatgatcgcaaagtaagaaggaactcaagggaagatgatgatcacagagagagaaagagctcaaggga |
114 |
Q |
| |
|
|||||||| ||| | |||||||||||||||| ||| | ||||||||||||||| ||||||| || || |||| || ||||||||| |
|
|
| T |
1734757 |
aagaactctaggtatgaggatgatcgcaaagaaaggaagaactcaagggaagaggatgatcgcaaagtaagaaggaactcaaggga |
1734672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University