View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16335_high_7 (Length: 213)
Name: NF16335_high_7
Description: NF16335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16335_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 84 - 198
Target Start/End: Complemental strand, 29835736 - 29835622
Alignment:
| Q |
84 |
atcctctatctccaaaatattcactttctacacccccatttccacctcttcacccatcatcaccaatgcttcatcacgccgcgcacccactttccctcga |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29835736 |
atcctctatctccaaaatattcactttctacacccccatttccacctcttcacccatcatcaccaatgcttcatcacgccgcgcacccactttccctcga |
29835637 |
T |
|
| Q |
184 |
gccatgtcttcttct |
198 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29835636 |
gccatgtcttcttct |
29835622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 11 - 60
Target Start/End: Complemental strand, 29835806 - 29835757
Alignment:
| Q |
11 |
catcatcaatggcgaacactttcactcttcctcgccacttcaacaaaaac |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29835806 |
catcatcaatggcgaacactttcactcttcctcgccacttcaacaaaaac |
29835757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University