View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16335_low_13 (Length: 205)
Name: NF16335_low_13
Description: NF16335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16335_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 183
Target Start/End: Original strand, 9465879 - 9466045
Alignment:
| Q |
17 |
atgaacgagggacagaaagagaggtatgcctatggagtgagaacctgggagtgaaaccagagaaagaggaatgacggtgaaggtgaaggtgacaacccca |
116 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9465879 |
atgaaagagggagagaaagagaggtatgcctatggagtgagaacctgggagtgaaaccagagaaagaggaatgacggtgaaggtgaaggtgacaacccca |
9465978 |
T |
 |
| Q |
117 |
aatactggtgtgagagtgagaacctaagaactcagactggtgttgatgttggcgaaatgttcttcgt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9465979 |
aatactggtgtgagagtgagaacctaagaactcagactggtgttgatgttggtgaaatgttcttcgt |
9466045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University