View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16337_high_2 (Length: 230)
Name: NF16337_high_2
Description: NF16337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16337_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 38878437 - 38878226
Alignment:
| Q |
1 |
cgcgttttgataaaccctaacaaaacccttcaagaaacaacaagcagacaaaatccctggcggaggttcgatcatagagactctgagatgaattacagcc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38878437 |
cgcgttttgataaaccctaataaaacccttcaagaaacaacaagtagacaaaatccctggcggaggttcgatcatagagactctgagatgaattacagcc |
38878338 |
T |
|
| Q |
101 |
gtttgatttccggcggaggaaggcttctccgacgactatgcacggctgcgacggcggctgagcttccgaataagaaggcaaacctttaccgaagactagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38878337 |
gtttgatttccggcggaggaaggcttctccgacgactatgcacggctgcgacggcggctgagcttccgaataagaaggcaaacctttaccgaagactagc |
38878238 |
T |
|
| Q |
201 |
gaacctagaaaa |
212 |
Q |
| |
|
| |||||||||| |
|
|
| T |
38878237 |
ggacctagaaaa |
38878226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University