View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16337_low_4 (Length: 230)

Name: NF16337_low_4
Description: NF16337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16337_low_4
NF16337_low_4
[»] chr1 (1 HSPs)
chr1 (1-212)||(38878226-38878437)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 38878437 - 38878226
Alignment:
1 cgcgttttgataaaccctaacaaaacccttcaagaaacaacaagcagacaaaatccctggcggaggttcgatcatagagactctgagatgaattacagcc 100  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38878437 cgcgttttgataaaccctaataaaacccttcaagaaacaacaagtagacaaaatccctggcggaggttcgatcatagagactctgagatgaattacagcc 38878338  T
101 gtttgatttccggcggaggaaggcttctccgacgactatgcacggctgcgacggcggctgagcttccgaataagaaggcaaacctttaccgaagactagc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38878337 gtttgatttccggcggaggaaggcttctccgacgactatgcacggctgcgacggcggctgagcttccgaataagaaggcaaacctttaccgaagactagc 38878238  T
201 gaacctagaaaa 212  Q
    | ||||||||||    
38878237 ggacctagaaaa 38878226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University