View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16338_low_1 (Length: 241)
Name: NF16338_low_1
Description: NF16338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16338_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 23220542 - 23220320
Alignment:
| Q |
1 |
aacaaataaattaacaataaagcgtaaacaagagttttgaggagaaattagatgtacataccctttgcctccgctgaaatcaaagagtggtaaagacgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23220542 |
aacaaataaattaacaataaagcgtaaacaagggttttcaggagaaattagatgtacataccctttgcctccgctgaaatcaaagagtggtaaagacgaa |
23220443 |
T |
 |
| Q |
101 |
acagctctcacatggtgaactgaccggagtaccggtggattgaacggccggcgaagaaacgggaaagtgggagatttaccggcgaggtgaaacgacgtag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23220442 |
acagctctcacatggtgaactgaccggagcgccggtggattgaacggccggcgaagaaacgggaaagtgggagatttacctgcgaggtgaaacgacgtag |
23220343 |
T |
 |
| Q |
201 |
tatttaggagtaataaggaagga |
223 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
23220342 |
tattgaggagtaataaggaagga |
23220320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 203
Target Start/End: Complemental strand, 23171918 - 23171882
Alignment:
| Q |
167 |
gtgggagatttaccggcgaggtgaaacgacgtagtat |
203 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
23171918 |
gtgggagatttaccggagaggtgagacgacgtagtat |
23171882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University