View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16339_low_2 (Length: 377)
Name: NF16339_low_2
Description: NF16339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16339_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 4 - 358
Target Start/End: Original strand, 9828074 - 9828428
Alignment:
| Q |
4 |
tcggatttttaaattattttcgttttagggtaaaatgagagtgatggaagatcggttgcttaggaataaagaacacaatcgggtgccatcttctcaagaa |
103 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9828074 |
tcggatttttaa-ttattttcgttttagggtaaaatgagagtgatggtagatcggttgcttaggaataaagaacacaatcgggtgtcatcttctcaagaa |
9828172 |
T |
|
| Q |
104 |
caaggtgcatatgacttatttgttaatctattgatgttagaagacgagaaacgatgtgatattactaaaataccatcaggggatgggtgcatggagggga |
203 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
9828173 |
cacggtgcatatgacttatttgttaatctattgatgttagaagacgagaaacgatgtgatattactaaaatcccatcaggggatgggtgcatggtgggga |
9828272 |
T |
|
| Q |
204 |
aactcgatccctaccagagatggggatggagatcaaaattcctaccc-accggagtacatgttcgggatttttgtggggaataatcggtgtttgggggtg |
302 |
Q |
| |
|
||||||||||||| ||||| ||||||||| ||||||||||| |||| |||||||||||||||||| ||| |||| || ||| |||| | ||||||||| |
|
|
| T |
9828273 |
aactcgatccctataagagacggggatggatatcaaaattccaaccctgccggagtacatgttcgggttttctgtgcgggatactcgggggttgggggtg |
9828372 |
T |
|
| Q |
303 |
agagaggtaaaactagtctccacccccattggtatatatacatatcaccaacatgg |
358 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9828373 |
agagaggtaaaactaatctccacccccattggtatatatacatatcaccaacatgg |
9828428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University