View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16339_low_3 (Length: 256)
Name: NF16339_low_3
Description: NF16339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16339_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 31860936 - 31860703
Alignment:
| Q |
17 |
aagttatatgtgttgtttgaaaatatacatgttgnnnnnnntctcacattgtttagaattaattgtaaagaaaggggagaccaaactatatatgagttat |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860936 |
aagttatatgtgttgattgaaaatatacatgttgaaaaaaatctcacattgtttagaattaattgtaaagaaaggggagaccaaactatatatgagttat |
31860837 |
T |
|
| Q |
117 |
agtttttgcttgcaaaatgtactggttgaaaacactcttgcattt-aaccnnnnnnnnnnnnnnccttgtcttatactcttgtcttagaatgttttaaga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860836 |
agtttttgcttgcaaaatgtactggttgaaaacactcttgcatttaaactttttttttttttttccttgtcttatactcttgtcttagaatgttttaaga |
31860737 |
T |
|
| Q |
216 |
tgtatttaatatttcctttggagggtgatgatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
31860736 |
tgtatttaatatttcctttggagggtgttgatgt |
31860703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University