View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1633_high_26 (Length: 305)
Name: NF1633_high_26
Description: NF1633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1633_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 289
Target Start/End: Complemental strand, 34883463 - 34883185
Alignment:
| Q |
13 |
gaagccacgtaatatgcatgtaaatcacaaactcagtcatgaatgatccttgtctaaggaaaatccaacggtgacaagtattactatgttcctagataga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34883463 |
gaagccacgtaatatgcatgtaaatcacaaactcactcatgaatgatccttgtctaaggaaaatccaacggtgac-agtattactatgttcctagataga |
34883365 |
T |
 |
| Q |
113 |
ctagactagattttgtaggtagtaaaacaaggtaacagtag---nnnnnnnnnnnnnnnnnngtcttgctgagtgaagatgaccaattttgttggactaa |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34883364 |
ctagactagattttgtaggtagcaaaacaaggtaacagtagtatcatcatcatcatcatcatgtcttgctgagtgaagatgaccaattttgttggactaa |
34883265 |
T |
 |
| Q |
210 |
ggttaccagttatgtcctgttattgtgccagtacaccacatcctcgtactgttaatgttgttggttcctcttcatgttct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34883264 |
ggttaccagttatgtcctgttattgtgcgagtacaccacatcctcgtactgttaatgttgttggttcctcttcatgttct |
34883185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University