View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1633_high_27 (Length: 301)
Name: NF1633_high_27
Description: NF1633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1633_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 85 - 273
Target Start/End: Complemental strand, 44858142 - 44857933
Alignment:
| Q |
85 |
agtaccggagggtaattaaattccagcatagcattgatgagaggatggaggacccattgttttaataagttcacatgccactaacactaatac------- |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858142 |
agtaccggagggtaattaaattccagcatagcattgatgagaggatggaggacccattgttttaataagttcacatgccactaacactaatactactatc |
44858043 |
T |
 |
| Q |
178 |
--------------atacactagatagatagtgacgtgtttggctatttcatgatccaccgcattcaaaattaaatatgagttgttgagtctcatttaat |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858042 |
acaaaacacaacacatacactagatagatagtgacgtgtttggctatttcatgatccaccgcattcaaaattaaatatgagttgttgagtctcatttaat |
44857943 |
T |
 |
| Q |
264 |
tccaattcat |
273 |
Q |
| |
|
|||||||||| |
|
|
| T |
44857942 |
tccaattcat |
44857933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 52
Target Start/End: Complemental strand, 44858177 - 44858145
Alignment:
| Q |
20 |
tgtaaaacaatgatgattgatgatgtaagtaga |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44858177 |
tgtaaaacaatgatgattgatgatgtaagtaga |
44858145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University