View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1633_high_31 (Length: 240)
Name: NF1633_high_31
Description: NF1633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1633_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 14369461 - 14369666
Alignment:
| Q |
11 |
ttattctgtgtttctctgagccacttggtatttccacttcttatatttctgaaatgcatggtgcattcggagcaattgaaatagcttttcaaagaggttg |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14369461 |
ttattctatgtttctctgagccacttggtatttccacttcttatatttctgaaatgcatggtgcattcagagcaattgaaatagcttttcaaagaggttg |
14369560 |
T |
 |
| Q |
111 |
gaggaacctatggatagaaacagattctcctttggtggttcttgcttttcaaagagatggaaaaacatgaagctcattctacgtcaaatgaattgcattg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14369561 |
gaggaacctatggatagaaacagattctcctttggtggttcttgcttttcaaagagatggaaaaacatgaagctcattctacgtcaaatgaattgcattg |
14369660 |
T |
 |
| Q |
211 |
tgactc |
216 |
Q |
| |
|
|||||| |
|
|
| T |
14369661 |
tgactc |
14369666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 99 - 169
Target Start/End: Complemental strand, 16009936 - 16009866
Alignment:
| Q |
99 |
tcaaagaggttggaggaacctatggatagaaacagattctcctttggtggttcttgcttttcaaagagatg |
169 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||| || || | ||||| |||||||||| |
|
|
| T |
16009936 |
tcaaagaggttggaggaacctttggatagaaacagattcttctttagtagtattggctttccaaagagatg |
16009866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University