View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1633_high_33 (Length: 237)
Name: NF1633_high_33
Description: NF1633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1633_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 14430727 - 14430497
Alignment:
| Q |
1 |
gaagaataaaatgggaatgggattgggagcagggttgcttggaggtgctttaggtgggatgttgattggagatatgatgtctgatgcttcttcttatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14430727 |
gaagaataaaatgggaatgggattgggagcagggttgcttggaggtgctttaggtgggatgttgattggagatatgatttctgatgcttcttcttatgat |
14430628 |
T |
|
| Q |
101 |
gctggatatgatgctggctttgatgatggtggttt------------tgatttttaattcatgtcttgttagcatcatttcacttttggtatctgttttt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14430627 |
gctggatatgatgctggctttgatgatggtggttttgatggtggttttgatttttaattcatctcttgttactatcatttcacttttggtatctgttttt |
14430528 |
T |
|
| Q |
189 |
atttgatttcgaggatgctttctggtgtttc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14430527 |
atttgatttcgaggatgctttctggtgtttc |
14430497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University