View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1633_high_34 (Length: 235)
Name: NF1633_high_34
Description: NF1633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1633_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 55518332 - 55518116
Alignment:
| Q |
1 |
cggttcaactgggttcggatcttgatcttgaacttgtagctgttgttgttgttccaccgtagcttcaccttcttcgtttcgttgatgatgatgttcatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55518332 |
cggttcaactgggttcggatcttgatcttgaacttgtagctgttgctgttgttcaaccgtagcttcaccttcttcgtttcgttgatgatgatgttcatgg |
55518233 |
T |
 |
| Q |
101 |
cggataattggacggaaaacccaggtggcaccacaacaacccataccggtgaatctgaagcgttctttaagactgcgtcttctggtagttcctgaatcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55518232 |
cggataattggacggaaaacccaggtggcaccacaacaacccataccggtgaatctgaagcgttctttaagactgcgtcttctggtggttcctgaatcta |
55518133 |
T |
 |
| Q |
201 |
aagcgtccatctgttcg |
217 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
55518132 |
aagcgtccatttgttcg |
55518116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 1560498 - 1560552
Alignment:
| Q |
18 |
gatcttgatcttgaacttgtagctgttgttgttgttccaccgtagcttcaccttcttc |
75 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
1560498 |
gatcttgatcttgaacttgta---gttgttgttgctctaccgtagcttcaccttcttc |
1560552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University