View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1633_high_35 (Length: 225)

Name: NF1633_high_35
Description: NF1633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1633_high_35
NF1633_high_35
[»] chr4 (1 HSPs)
chr4 (1-214)||(55518455-55518665)
[»] chr2 (1 HSPs)
chr2 (77-214)||(8902886-8903023)
[»] chr8 (1 HSPs)
chr8 (116-209)||(4176009-4176102)


Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 55518455 - 55518665
Alignment:
1 agtttcattgatgaaactgttggaggaaacggaaggtgaaaatgagagtaatgctgctggtgcggtagttgtggaagggagtgattcggtgtgctgcgtg 100  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||    
55518455 agtttcgttgatgaaactgttggaggaaacggaaggtgaaaatgagagtaatgct---ggtgcggtagttgtggaagggagtgattcggtgtgctgcgtg 55518551  T
101 tgcatgggaagaaagaaaggtgcagcgttcataccgtgtggacacactttttgcagagtgtgttcaagggaactgtggttgaatcgaggaaattgtcccc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55518552 tgcatgggaagaaagaaaggtgcagcgttcataccgtgtggacacactttttgcagagtgtgttcaagggaactgtggttgaatcgaggaaattgtcccc 55518651  T
201 tttgtaatcgttct 214  Q
    ||||||||||||||    
55518652 tttgtaatcgttct 55518665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 77 - 214
Target Start/End: Original strand, 8902886 - 8903023
Alignment:
77 gggagtgattcggtgtgctgcgtgtgcatgggaagaaagaaaggtgcagcgttcataccgtgtggacacactttttgcagagtgtgttcaagggaactgt 176  Q
    |||| |||||| ||||| || ||||||||||| || || |||||||| ||||| || || |||||||| ||||||||||| || ||||| ||||| ||||    
8902886 gggaatgattcagtgtgttgtgtgtgcatggggaggaataaaggtgcggcgtttattccatgtggacatactttttgcagggtttgttctagggagctgt 8902985  T
177 ggttgaatcgaggaaattgtcccctttgtaatcgttct 214  Q
    |||||||| ||||   ||||||||||||||||||||||    
8902986 ggttgaatagaggctcttgtcccctttgtaatcgttct 8903023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 209
Target Start/End: Original strand, 4176009 - 4176102
Alignment:
116 aaaggtgcagcgttcataccgtgtggacacactttttgcagagtgtgttcaagggaactgtggttgaatcgaggaaattgtcccctttgtaatc 209  Q
    |||||||||||||| ||||| ||||||||||| ||||||||  |||||||||| || || ||| | | | |||| |||||||| ||||| ||||    
4176009 aaaggtgcagcgtttataccatgtggacacacgttttgcaggatgtgttcaagagagctttgggttagtagagggaattgtcctctttgcaatc 4176102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University