View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1633_low_21 (Length: 352)
Name: NF1633_low_21
Description: NF1633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1633_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 19 - 338
Target Start/End: Complemental strand, 26415232 - 26414911
Alignment:
| Q |
19 |
taatgttgtttgtggtgtggtgtgctaagttt-tattgtctgcaactggtttgtttctatcacattgctttatttgccactccaaaggattttgggggca |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26415232 |
taatgttgtttgtggtgtggtgggctaagtttctattgtctgcaactggtttgtttctgtcacattgctttatttgccactccaaaggattttgggggca |
26415133 |
T |
|
| Q |
118 |
catacatgtgccggtctgttgttgaagccatatttgttcttcaatggcatggcatctctcactgccagcaacgaaccatcagaagcaacctaatacaggc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26415132 |
catacatgtgccggtctgttgttgaagccatatttgttcttcaatggcatggcatctctcactgccagcaacgaaccatcagaagcaacctaatacaggc |
26415033 |
T |
|
| Q |
218 |
aattctgtttaggacgactaacatgctctcttggatgcatttatcggtgcaagtatctgaaggagtaacggtatgaacattctcttacaaacaaaactaa |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
26415032 |
aattctgtttaggacgattaacatgctctcttggatgcatttatcggtgcaagtatctgaaggagtaacagtatgaacattctcttacaaacgaaactaa |
26414933 |
T |
|
| Q |
318 |
catg-ttgaactaagtcaatct |
338 |
Q |
| |
|
|||| ||| ||||||||||||| |
|
|
| T |
26414932 |
catgcttggactaagtcaatct |
26414911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 66; Significance: 4e-29; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 31 - 120
Target Start/End: Original strand, 27985517 - 27985605
Alignment:
| Q |
31 |
tggtgtggtgtgctaagttttattgtctgcaactggtttgtttctatcacattgctttatttgccactccaaaggattttgggggcacat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
27985517 |
tggtgtggtgtgctaagttttattgtctgcaactggtttgtttctgtcacattgcttcttttgccactccaaatga-tttgggggcacat |
27985605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 31 - 120
Target Start/End: Original strand, 28072048 - 28072136
Alignment:
| Q |
31 |
tggtgtggtgtgctaagttttattgtctgcaactggtttgtttctatcacattgctttatttgccactccaaaggattttgggggcacat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
28072048 |
tggtgtggtgtgctaagttttattgtctgcaactggtttgtttctgtcacattgcttcttttgccactccaaatga-tttgggggcacat |
28072136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 144 - 206
Target Start/End: Original strand, 27985613 - 27985675
Alignment:
| Q |
144 |
gccatatttgttcttcaatggcatggcatctctcactgccagcaacgaaccatcagaagcaac |
206 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
27985613 |
gccatatttgttcttcaacaacatggtatctctcaccgccagcaacgaaccatcacaagcaac |
27985675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 144 - 206
Target Start/End: Original strand, 28072144 - 28072206
Alignment:
| Q |
144 |
gccatatttgttcttcaatggcatggcatctctcactgccagcaacgaaccatcagaagcaac |
206 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
28072144 |
gccatatttgttcttcaacaacatggtatctctcaccgccagcaacgaaccatcacaagcaac |
28072206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 67 - 103
Target Start/End: Complemental strand, 40200742 - 40200706
Alignment:
| Q |
67 |
tttgtttctatcacattgctttatttgccactccaaa |
103 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
40200742 |
tttgttgctatcacattgcttcatttgccactccaaa |
40200706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University