View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1633_low_26 (Length: 309)
Name: NF1633_low_26
Description: NF1633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1633_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 9424458 - 9424592
Alignment:
| Q |
1 |
tcaagctaactattgtttttgttctctcttcatgaccaaatataatgtaacaatggaatgtaaatcagaaaatatatatgatctattgtttcatgcatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424458 |
tcaagctaactattgtttttgttctctcttcatgaccaaatataatgtaacaatggaatgtaaatcagaaaatatatatgatctattgtttcatgcatcc |
9424557 |
T |
 |
| Q |
101 |
tttgtgacaaaatataaaagagatctataagtcaa |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424558 |
tttgtgacaaaatataaaagagatctataagtcaa |
9424592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 9424836 - 9424896
Alignment:
| Q |
190 |
gcttatagagttatatagtgtatatttagggtacataggctagagtttggtaattgaattat |
251 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
9424836 |
gcttatagagt-atatagtgtatatttagggtacataggatagagtttggtaatagaattat |
9424896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 171
Target Start/End: Original strand, 9424765 - 9424809
Alignment:
| Q |
127 |
ataagtcaaatgtttttctctaaattttagactaaatacatttca |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424765 |
ataagtcaaatgtttttctctaaattttagactaaatacatttca |
9424809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University