View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1633_low_35 (Length: 239)
Name: NF1633_low_35
Description: NF1633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1633_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 33106154 - 33106286
Alignment:
| Q |
1 |
cctaatatttcgtctactgcgataatcattcaaacaaaatggcaatttcacgcactggagtttacgtcgatgactatttggagtgtaagctccttttatt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33106154 |
cctaatatttcttctactgcgataatcattcaatcaaaatggcaattgcacgcactggagtctacgtcgatgactatttggagtgtaagctccttttatt |
33106253 |
T |
 |
| Q |
101 |
ttcaattctctccatttaaccctaatcctaatt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33106254 |
ttcaattctctccatttaaccctaatcctaatt |
33106286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 185 - 223
Target Start/End: Original strand, 33106332 - 33106370
Alignment:
| Q |
185 |
ctattcaacagatgccaatacattgcccgctgagcttca |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33106332 |
ctattcaacagatgccaatacattgcccgctgagcttca |
33106370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University