View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1633_low_36 (Length: 238)
Name: NF1633_low_36
Description: NF1633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1633_low_36 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 38998180 - 38997961
Alignment:
| Q |
19 |
acctgtaagcataggaggaattccatcatctcctaaaatgcctacatcccatcctttgataacctatatgattcatgaataatttgttaacaatgagcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38998180 |
acctgtaagcataggaggaattccatcatctcctaaaatgcctacatcccatcctttgataacctatatgattcatgaataatttgttaacaatgagcat |
38998081 |
T |
 |
| Q |
119 |
ggcatatatatcagtgaactttgtaacaagtaacaacttatagaaggtagaaaatatactttaaggtagagattcaacaattttatgatttcaccaatca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
38998080 |
ggcatatatatcagtgaactttgtaacaagtaacaacttatagaaggtagaaaatatactttaaggtagaaattcaacaattttctgatttcaccaatca |
38997981 |
T |
 |
| Q |
219 |
atatctcataagagctttac |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38997980 |
atatctcataagagctttac |
38997961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University