View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16340_high_4 (Length: 268)
Name: NF16340_high_4
Description: NF16340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16340_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 52543147 - 52543398
Alignment:
| Q |
1 |
tccaccactctaccttgccaagaattcccaaaacactcgtcgtcaaccagtgattcgcggcgcgccacatgttttgcagccatgacagccgtcaattctt |
100 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52543147 |
tccaccactctacctttggacgaattcccaaaacactcgtcgtcaaccaatgattcgcggagcgccacatgttttgcagccataacagccgtcaattctt |
52543246 |
T |
 |
| Q |
101 |
tgggaatattcaaccgggcagaataacaaaccctaatggctggtgtgtcctgacaagggaaaacagaacgggcatgaatggcttggcattgagtatagac |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52543247 |
tgggaatattcaaccgggccgaataacaaaccctaatggctggtgtgtcctgacaagggaaaacagaacgggcatgaatggcttggcattgagtatagac |
52543346 |
T |
 |
| Q |
201 |
aaaagggtgttttttgtcgaaagtttgaggaggtaagagccattgaagagca |
252 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52543347 |
aaaagggtgttttttgttgaaagtttgaggaggtaagagccattgaagagca |
52543398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University