View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16343_high_3 (Length: 306)
Name: NF16343_high_3
Description: NF16343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16343_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 13 - 289
Target Start/End: Complemental strand, 22558233 - 22557957
Alignment:
| Q |
13 |
aaaatattcgaatatctcctccaaaaaattttgtaacatctctttctatttcgagacttgaagtacctggtggctggtactttgttggacaatattttgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22558233 |
aaaatattcgaatatctcctccaaaaaaatttgtaacatctctttctatttcgagacttgaagtacctggtggctggtactttgttggacaatattttgt |
22558134 |
T |
 |
| Q |
113 |
cttccatgttgttcatatatgtggtgtctttgtttgtagtcgtttaatattttctgcaaaagaattcaacttagttgttcacatatgtgattttcctact |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22558133 |
cttccatgttgttcatatatgtggtgtctttgtttgtagtcgtttaatattttctgcaaaagaattcaacttagttgttcatatatgtgattttcctact |
22558034 |
T |
 |
| Q |
213 |
agtgttatcattggttgaaagtggtcttggggtgtttgcttggggatgaatttttcggtctagtctgcataattatg |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22558033 |
agtgttatcattggttgaaagtggtcttggggtgtttgcttggggatggatttttcggtctagtctgcataattatg |
22557957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University