View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16343_low_8 (Length: 219)
Name: NF16343_low_8
Description: NF16343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16343_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 23928469 - 23928650
Alignment:
| Q |
17 |
aatatgacggagcaaaaaagcacatgcaaatcactcaatggtgcgcgcacaacagcttcctgtacagaaacgttggagcaacaagcgacacgttgaaaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23928469 |
aatatgacggagcaaaaaagcacatgcaaatcactcaatggtgcgcgcacaacagcttcctgtacagaaacgttggagcaacaagcgacacgttgaaaac |
23928568 |
T |
 |
| Q |
117 |
caacaacgggacgactcaaatgcaatatagacacgtccttcttcaccacttggaattgtgtggggttttcgatatgtattcg |
198 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23928569 |
cagcaacgggacaactcaaatgcaatatagacacgtccttcttcaccacttggaattgtgtggggttttcgatatgtattcg |
23928650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University