View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16344_low_14 (Length: 248)
Name: NF16344_low_14
Description: NF16344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16344_low_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 33016581 - 33016343
Alignment:
| Q |
18 |
atttagaccttcctccactgattggaagaggcaaaaatagtgnnnnnnnnnn--attggatttataaatgattgtacttggagccgagttcaatattgga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33016581 |
atttagaccttcctccactgattggaagaggcaaaaatagtgttttttttttttattggatttataaatgattgtacttggagccgagttcaatattgga |
33016482 |
T |
 |
| Q |
116 |
gttctaaatgtctttgtagagcgggtaacaaggtcctcactacatcggcagttcagtccatccctacctattgtatgagtgc------attccgcttgcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33016481 |
gttctaaatgtctttgtagagcgggtaacaaggtcctcactacatcggcagttcagtccatccctacctattgtatgagtgcattcgcattccgcttgcc |
33016382 |
T |
 |
| Q |
210 |
ctccactcttactttagagactgaacatatcaattcctt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33016381 |
ctccactcttactttagagactgaacatatcaattcctt |
33016343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University