View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16344_low_9 (Length: 338)
Name: NF16344_low_9
Description: NF16344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16344_low_9 |
 |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |  |
|
| [»] scaffold0426 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold1694 (1 HSPs) |
 |  |  |
|
| [»] scaffold0481 (1 HSPs) |
 |  |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold1327 (1 HSPs) |
 |  |  |
|
| [»] scaffold0896 (1 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 40)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 331
Target Start/End: Original strand, 35807573 - 35807879
Alignment:
| Q |
19 |
caaactactagtctcacattacttaggtagtgccaatgaatgctgaggttgcacttgtgtattgtctatatcaaaattggttcatctgaattcataaggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35807573 |
caaactactagtctcacattacttaggtagtgccaatgaatgctgaggttgcacttgtgtattgtctatatcaaaattggttcatctgaattcataaggt |
35807672 |
T |
 |
| Q |
119 |
ctagtctaaataattggaaacctatgattcattttgatttggatagggac-ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35807673 |
ctagtctaaataattggaaacctatgggtcattttgatttggatagggactttttttattggtgttcggggttcgaacctcaaaccttgcatatattatg |
35807772 |
T |
 |
| Q |
218 |
cacattgtccttatcaactgagtttagctcatggggacgatttggacagggactagtctaaatatactattacttgatgaataaagaataaattttatga |
317 |
Q |
| |
|
|||||||| |||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35807773 |
cacattgttcttaccaactgag-------cttggggacgatttggacagggactagtctaaatatactattacttgatgaataaagaataaactttatga |
35807865 |
T |
 |
| Q |
318 |
ataaattcatatca |
331 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35807866 |
ataaattcatatca |
35807879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 192 - 241
Target Start/End: Complemental strand, 40446038 - 40445991
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40446038 |
gaacctcagaccttgcatatattatg--cattgtccttatcaactgagtt |
40445991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 22499003 - 22498943
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||| |||||||||| |||||| |
|
|
| T |
22499003 |
ggggttcgaacc-cagaccttgcatatattatg--cattgtccttaccaactgagttaagctca |
22498943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 172 - 239
Target Start/End: Original strand, 42168931 - 42168996
Alignment:
| Q |
172 |
tttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
42168931 |
tttggtggtgtctggggttcgaaccccagaccttgcatatactatg--cattgtccttaccaactgag |
42168996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 248
Target Start/End: Complemental strand, 781924 - 781864
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||| |||||||||||||| |||| ||||||||| ||||||||||||| |||||| |
|
|
| T |
781924 |
gggttcgaaccccagaccttgcatattttat--acattgtccctatcaactgagttaagctca |
781864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 8545003 - 8545049
Alignment:
| Q |
200 |
gaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
8545003 |
gaccttgcatatattatgca--ttgtccttatcaactgagttaagctca |
8545049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 188 - 248
Target Start/End: Original strand, 23118053 - 23118111
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||| || ||||| ||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
23118053 |
gttcgaaccccaaaccttacatatattatgca--ttgtccttatcaactgagttaagctca |
23118111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 217
Target Start/End: Complemental strand, 3222793 - 3222761
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3222793 |
ggggttcgaacctcagaccttgcatatattatg |
3222761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 3671280 - 3671219
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
3671280 |
ggggttcgaaccctggaccttgcatatattat--acattatccttatcaactgagttaagctca |
3671219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 257
Target Start/End: Original strand, 7630160 - 7630245
Alignment:
| Q |
170 |
tttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacga |
257 |
Q |
| |
|
||||| |||||||||| | |||||||| |||| |||||||||||||| ||||||| ||| || ||||||| |||||| |||||||| |
|
|
| T |
7630160 |
ttttttttggtgtttgagattcgaaccatagacattgcatatattatg--cattgtctttagcatctgagttaagctcacggggacga |
7630245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 8639344 - 8639389
Alignment:
| Q |
201 |
accttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
8639344 |
accttgcatatatta--cacattgtccttatcaactgagttaagctca |
8639389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 169 - 260
Target Start/End: Complemental strand, 15889489 - 15889400
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacgattt |
260 |
Q |
| |
|
||||||| ||||| | |||||| ||||| ||||||||||||||||||| |||||||| || |||||||| | |||||| | ||||||||| |
|
|
| T |
15889489 |
ttttttggtggtggtcggggtttgaaccctagaccttgcatatattatg--cattgtccctaccaactgagctaagctcacgaggacgattt |
15889400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 252
Target Start/End: Original strand, 17145351 - 17145412
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggg |
252 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| ||| |||||||||| |||| ||||| |
|
|
| T |
17145351 |
ttcgaacctcagatcttgcatatattat--acattgtctttaccaactgagttaagcttatggg |
17145412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 219
Target Start/End: Original strand, 31708127 - 31708179
Alignment:
| Q |
167 |
acttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||| |||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
31708127 |
acttttttggtggtgtccgaggttcgaaccccagaccttgcatatattatgca |
31708179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 18147571 - 18147615
Alignment:
| Q |
202 |
ccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
18147571 |
ccttgcatatattat--acattgtccttatcaactgagttaagctca |
18147615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 239
Target Start/End: Original strand, 790129 - 790198
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| ||||||| ||||||||||||| ||||||||||||||| | |||||||| ||||||||||| |
|
|
| T |
790129 |
ttttttggtggtgttcggggttcgaacctgcgaccttgcatatatt-tatacattgtctatatcaactgag |
790198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 1642412 - 1642362
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| ||||||| |||||||||||| |||| ||||||||||||||||| |
|
|
| T |
1642412 |
tttttttttggtgtctggggttcgaactccagatcttgcatatattatgca |
1642362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 219
Target Start/End: Original strand, 5107244 - 5107278
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
5107244 |
ggggttcgaacctcggaccttgcatatattatgca |
5107278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 255
Target Start/End: Original strand, 8882399 - 8882466
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||| ||||| | |||||| |||||||||||||| |||| |||||||||||||| |||||| |||||| |
|
|
| T |
8882399 |
gggtttgaaccccggaccttacatatattatgcac--tgtcattatcaactgagttaagctcacggggac |
8882466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 219
Target Start/End: Complemental strand, 11017234 - 11017204
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11017234 |
ttcgaacctcagaccttgcatatattatgca |
11017204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 217
Target Start/End: Original strand, 16071394 - 16071440
Alignment:
| Q |
171 |
ttttgttggtgtttggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
||||| |||||| ||||||||||||| ||||||||||| |||||||| |
|
|
| T |
16071394 |
ttttggtggtgtatggggttcgaaccccagaccttgcacatattatg |
16071440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 256
Target Start/End: Complemental strand, 17144539 - 17144472
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacg |
256 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| |||| || ||||||| || ||| ||||||| |
|
|
| T |
17144539 |
ggttcgaatctcagaccttgcatatattatg--cattgttcttaacagctgagttaagttcacggggacg |
17144472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 18391660 - 18391601
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
18391660 |
ggttcgaacctcggaccttgcatattttatg--cattgtccttaccaactgagctaagctca |
18391601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 2475341 - 2475386
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
2475341 |
ttttttggtggtgtctggggttcgaacctgggaccttgcatatatt |
2475386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 4374924 - 4374969
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
4374924 |
ttttttggtggtgtctggggttcgaacccgagaccttgcatatatt |
4374969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 5589534 - 5589579
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
5589534 |
ttttttggtggtgtctggggttcgaacctgggaccttgcatatatt |
5589579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 6928427 - 6928472
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6928427 |
ttttttggtggtgtctggggttcgaacctgggaccttgcatatatt |
6928472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 11647255 - 11647205
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||||| || ||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
11647255 |
ttcgaaccccaaaccttgcatatattatg--cattgtccttaccaactgagtt |
11647205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 236
Target Start/End: Original strand, 25607060 - 25607106
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaact |
236 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
25607060 |
gttcgaaccccagaccttgcatatattatg--cattgtctttatcaact |
25607106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 248
Target Start/End: Complemental strand, 39914971 - 39914902
Alignment:
| Q |
176 |
ttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| | |||||||||||| | |||||||||||||||||| ||||||||||| ||| |||||| |||||| |
|
|
| T |
39914971 |
ttggtggtcggggttcgaacc-cggaccttgcatatattatg--cattgtccttaccaattgagttaagctca |
39914902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 239
Target Start/End: Original strand, 2705518 - 2705567
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
2705518 |
gttcgaacctcagaccttacatatattatg--tattgttcttatcaactgag |
2705567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 6489069 - 6489008
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| |||||||| || |||||||| | |||||| |
|
|
| T |
6489069 |
ggggtttgaaccccagaccttgcatatattatg--cattgtccctaccaactgagctaagctca |
6489008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 16133072 - 16133125
Alignment:
| Q |
193 |
aacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
16133072 |
aacctctgaccttgcatatattatg--cattgtccttaccaactgagctaagctca |
16133125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 187 - 219
Target Start/End: Original strand, 17465396 - 17465428
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
17465396 |
ggttcgaaccccagaccttgcatatattatgca |
17465428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 248
Target Start/End: Original strand, 25603983 - 25604060
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||||| ||| |||||||| | |||||||||||||||||||| ||||| ||||||||||| | |||||| |
|
|
| T |
25603983 |
ttttttgttggtggccgggattcgaaccccgaaccttgcatatattatgcac--tgtccatatcaactgagctaagctca |
25604060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 27479631 - 27479684
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcata-tattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
27479631 |
ggttcgaaccccagaccttgcatattattat--acattgtacttatcaactgagtt |
27479684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 248
Target Start/End: Original strand, 32200430 - 32200507
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||||| | |||| | ||||| | |||||||||||||||||| |||||||| | ||||||||| | |||||| |
|
|
| T |
32200430 |
ttttttgttggtggtcggggcttgaaccccggaccttgcatatattatg--cattgtccctgtcaactgagctaagctca |
32200507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 34702548 - 34702491
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||| | |||||| ||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
34702548 |
ttcgaaccccggacctttcatatattatgca--ttgtccttaccaactgagttaagctca |
34702491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 35109458 - 35109401
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| ||| |||||||||| |||||| |
|
|
| T |
35109458 |
ttcgaacctcggaccttgcatatattatg--tattgtctttaccaactgagttaagctca |
35109401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 43108615 - 43108570
Alignment:
| Q |
201 |
accttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
43108615 |
accttgcatatattatgca--ttgtccttaccaactgagttaagctca |
43108570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 52)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 169 - 255
Target Start/End: Original strand, 21914054 - 21914138
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||| || ||||| |||||||||||| || ||||||||||||||||| ||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
21914054 |
ttttttttttgtgttaggggttcgaaccccataccttgcatatattatg--cattgtccttaccaactgagttaagctcatggggac |
21914138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 255
Target Start/End: Complemental strand, 45096096 - 45096020
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||| | || |||||||||| |
|
|
| T |
45096096 |
tggtgtctggggttcgaaccacagaccttgcatatattatg--cattgtccttatcaactgagctaagttcatggggac |
45096020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 255
Target Start/End: Original strand, 25505701 - 25505768
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
25505701 |
gggttcgaaccccagaccttgcatatattatg--cattgtccttacaaactgagttaagctcatggggac |
25505768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 169 - 248
Target Start/End: Complemental strand, 30200904 - 30200827
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
30200904 |
tttttttttggtgtccggggttcgaacctcaaaccttgcatatattatg--cattgtccttagcaactgagctaagctca |
30200827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 169 - 239
Target Start/End: Original strand, 35191800 - 35191868
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| ||||| ||||||||||||| |||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
35191800 |
ttttttggcggtgtctggggttcgaaccccagaccttgcatatattatg--cattgtccttaccaactgag |
35191868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 183 - 255
Target Start/End: Complemental strand, 17588426 - 17588356
Alignment:
| Q |
183 |
ttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||| |||||||| |||| ||||||||||||||| ||||||||||| |||||||||| |||||| |||||| |
|
|
| T |
17588426 |
ttgggattcgaaccccagatcttgcatatattatg--cattgtccttaccaactgagttaagctcacggggac |
17588356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 177 - 217
Target Start/End: Original strand, 41990575 - 41990615
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41990575 |
tggtgtttggggttcgaacctcggaccttgcatatattatg |
41990615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 255
Target Start/End: Complemental strand, 53208031 - 53207964
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||| ||||| |||||||| | |||||| |||||| |
|
|
| T |
53208031 |
gggttcgaaccccagaccttgcatatattatg--cattgcccttaccaactgagctaagctcacggggac |
53207964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 169 - 241
Target Start/End: Original strand, 1111824 - 1111894
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
||||||||| ||| | |||||| ||||| |||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
1111824 |
ttttttgtttgtggtcggggtttgaaccccagaccttgcatatattatg--tattgtccctatcaactgagtt |
1111894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 27397611 - 27397665
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||| || |||||||||| |
|
|
| T |
27397611 |
ggggttcgaaccttagaccttgcatatattat--acattgtccataccaactgagtt |
27397665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 250
Target Start/End: Original strand, 39100420 - 39100478
Alignment:
| Q |
190 |
tcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatg |
250 |
Q |
| |
|
|||||||||| |||||| |||||||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
39100420 |
tcgaacctcaaaccttgtatatattatgca--ttgttcttatcaactgagttaagctcatg |
39100478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 168 - 248
Target Start/End: Original strand, 51250215 - 51250293
Alignment:
| Q |
168 |
cttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| ||||| | |||||| |||| |||| ||||||||||||||| |||||||||||| |||||||||| |||||| |
|
|
| T |
51250215 |
ctttttttgtggtgatcggggtttgaacttcaggccttgcatatattat--acattgtccttaccaactgagttaagctca |
51250293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 13042791 - 13042860
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| | |||||| ||| |||||||| | |||||| |
|
|
| T |
13042791 |
tggtgtttggggttcgaaccccggaccttgcatatattat--aaattgtctttaccaactgagctaagctca |
13042860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 13050868 - 13050937
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| | |||||| ||| |||||||| | |||||| |
|
|
| T |
13050868 |
tggtgtttggggttcgaaccccggaccttgcatatattat--aaattgtctttaccaactgagctaagctca |
13050937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 169 - 217
Target Start/End: Complemental strand, 20400155 - 20400107
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
|||||| ||||| | ||||||| |||||||||||||||||||||||||| |
|
|
| T |
20400155 |
tttttttttggtatctggggtttgaacctcagaccttgcatatattatg |
20400107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 169 - 248
Target Start/End: Original strand, 38573556 - 38573633
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||| |||||||||| | |||||||| |||||||||| |||||| ||||||||||||||| |||||| |
|
|
| T |
38573556 |
ttttttggtggtgtccggggttcgaatcctagaccttgtatatattatg--cattgttcttatcaactgagttaagctca |
38573633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 186 - 248
Target Start/End: Original strand, 1149069 - 1149129
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
1149069 |
gggttcgaaccctagaccttgcatatattatg--cattgtccttaccaactgagctaagctca |
1149129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 1456546 - 1456590
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactga |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
1456546 |
gaacctcagaccttgcatatattat--acattgtccctatcaactga |
1456590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 239
Target Start/End: Original strand, 4216383 - 4216450
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| |||||| ||||||||||| | |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4216383 |
ttttttggtggtgtccagggttcgaacccc-gaccttgcatatattatg--cattgtccttatcaactgag |
4216450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 170 - 217
Target Start/End: Original strand, 7101777 - 7101823
Alignment:
| Q |
170 |
tttttgttggtgtttggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
|||||| |||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
7101777 |
tttttggtggtgtttggggttcgaa-ctcggaccttgcatatattatg |
7101823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 188 - 219
Target Start/End: Complemental strand, 42074162 - 42074131
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42074162 |
gttcgaacctcagaccttgcatatattatgca |
42074131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 185 - 239
Target Start/End: Original strand, 54230098 - 54230150
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||||||||||| || ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
54230098 |
ggggttcgaaccccaaaccttgcatatattatg--cattgtccttaccaactgag |
54230150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 255
Target Start/End: Complemental strand, 55126076 - 55126000
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||||||||| |||||||| |||||||||| | |||||| |||||| |
|
|
| T |
55126076 |
tggtgtctggggtttgaacctcgaaccttgcatatattatg--tattgtcctcatcaactgagctaagctcacggggac |
55126000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 256
Target Start/End: Original strand, 5702179 - 5702245
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacg |
256 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| |||| |||||||| | |||||| ||||||| |
|
|
| T |
5702179 |
ggttcgaacctcaaaccttgcatatattatg--cattgt-cttaccaactgagctaagctcacggggacg |
5702245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 219
Target Start/End: Complemental strand, 8075847 - 8075813
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
8075847 |
ggggtttgaacctcagaccttgcatatattatgca |
8075813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 219
Target Start/End: Complemental strand, 8139773 - 8139743
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8139773 |
ttcgaacctcagaccttgcatatattatgca |
8139743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 219
Target Start/End: Original strand, 13829076 - 13829110
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
13829076 |
ggggttcgaaccccagaccttgcatatattatgca |
13829110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 219
Target Start/End: Complemental strand, 14771389 - 14771359
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14771389 |
ttcgaacctcagaccttgcatatattatgca |
14771359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 200 - 257
Target Start/End: Complemental strand, 33771737 - 33771682
Alignment:
| Q |
200 |
gaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacga |
257 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| |||||| | |||||| |
|
|
| T |
33771737 |
gaccttgcatatattat--acattgtccttaccaactgagttaagctcacgaggacga |
33771682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 34899175 - 34899125
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||||| | |||||| ||||| | |||||||||||||||||||| |
|
|
| T |
34899175 |
ttttttgttggtggtcggggtttgaaccccggaccttgcatatattatgca |
34899125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 250
Target Start/End: Original strand, 39869810 - 39869869
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatg |
250 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||||||||| |||||||||| | |||||| |
|
|
| T |
39869810 |
ttcgaacctcggaccttgtatatattatg--cattgtccttaccaactgagttaaactcatg |
39869869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 219
Target Start/End: Original strand, 45885476 - 45885510
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
45885476 |
ggggtttgaacctcagaccttgcatatattatgca |
45885510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Original strand, 46226008 - 46226058
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| |||||||| ||||||||||| | |||||||||||||||||||| |
|
|
| T |
46226008 |
tttttttttggtgttcggggttcgaactccggaccttgcatatattatgca |
46226058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 255
Target Start/End: Original strand, 53681877 - 53681944
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||| |||| |||||||| | |||||| |||||| |
|
|
| T |
53681877 |
gggttcgaacctcaaatcttgcatatattatg--cattgttcttaccaactgaggtaagctcacggggac |
53681944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 7829954 - 7829904
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||||||| ||||||||||||| |
|
|
| T |
7829954 |
ttcgaacttcagaccttacatatattatg--cattgtccatatcaactgagtt |
7829904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 12976605 - 12976655
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||| | |||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
12976605 |
ttcgaatcccagaccttgcatatattatg--cattgtccctatcaactgagtt |
12976655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 248
Target Start/End: Complemental strand, 21513351 - 21513289
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||| |||||||| ||||||||||||| |||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
21513351 |
tgggattcgaaccccagaccttgcataaattatg--cattgtccttaccaactgagctaagctca |
21513289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 207 - 255
Target Start/End: Complemental strand, 22462352 - 22462306
Alignment:
| Q |
207 |
catatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
22462352 |
catatattatgca--ttgtccttatcaactgagttaagctcacggggac |
22462306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 30269151 - 30269196
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
30269151 |
ttttttggtggtgtctggggttcgaacccgagaccttgcatatatt |
30269196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 41990832 - 41990877
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
41990832 |
ttttttgttggtgtccggggttcgaacctgcgaccttgcatatatt |
41990877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 248
Target Start/End: Original strand, 43796819 - 43796897
Alignment:
| Q |
168 |
cttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||| |||||| |||||| ||||||||| || |||||||||| |||||| |
|
|
| T |
43796819 |
ctttttttatggtgtcagggattcgaacctcagactttgcatgtattat--acattgtccataccaactgagttaagctca |
43796897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 219
Target Start/End: Original strand, 46253897 - 46253930
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
46253897 |
gggttcgaacctcagaccttgcatatactatgca |
46253930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 5117266 - 5117209
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||| ||||| ||||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
5117266 |
ttcgaacctcaaaccttacatatattatg--tattgtccttatcaactgagctaagctca |
5117209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 221
Target Start/End: Original strand, 6835850 - 6835886
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcaca |
221 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6835850 |
ggggttcgaaccctagaccttgcatatattatgcaca |
6835886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 19468509 - 19468452
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||||||| || |||||||||| |||||| |
|
|
| T |
19468509 |
ttcgaaccacggaccttgcatatattatg--cattgtccataccaactgagttaagctca |
19468452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 23147969 - 23148038
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||||||||| | ||||| |||||||||||| |||||||||| |||||||| | |||||| |
|
|
| T |
23147969 |
tggtgttcggggttcgaaccccggacctcgcatatattatg--tattgtccttaccaactgagctaagctca |
23148038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 217
Target Start/End: Complemental strand, 24273685 - 24273653
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
24273685 |
ggggttcaaacctcagaccttgcatatattatg |
24273653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 184 - 255
Target Start/End: Complemental strand, 33745162 - 33745093
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| ||||| |||||||||||||| ||||| |||||||| |||||| |||| | |||||| |||||| |
|
|
| T |
33745162 |
tggggtttgaaccccagaccttgcatattttatg--cattgtccatatcaattgagctaagctcacggggac |
33745093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 248
Target Start/End: Original strand, 38130958 - 38131019
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| ||||| | |||||||||||||||||| |||||||| || |||||||||| |||||| |
|
|
| T |
38130958 |
ggggtttgaaccccggaccttgcatatattatg--cattgtccataccaactgagttaagctca |
38131019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 247
Target Start/End: Original strand, 49975811 - 49975864
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctc |
247 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||| || |||||||||| ||||| |
|
|
| T |
49975811 |
gaaccccagaccttgcatatattatg--cattgtccataacaactgagttaagctc |
49975864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 52119438 - 52119377
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
52119438 |
ggggttcgaaccccgaaccttgcatatattatg--cattgtccttaccaactgagctaagctca |
52119377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 53996357 - 53996300
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| || |||||||| | |||||| |
|
|
| T |
53996357 |
ttcgaaccccagaccttgcatatattatg--cattgtccataccaactgagctaagctca |
53996300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 40)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 169 - 248
Target Start/End: Complemental strand, 6384929 - 6384852
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||| | ||||||||||| |||||||||||||||||||| |||||||||||| ||||||||| |||||| |
|
|
| T |
6384929 |
ttttttggtggtgtctagggttcgaaccccagaccttgcatatattatg--cattgtccttattaactgagttaagctca |
6384852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 169 - 255
Target Start/End: Original strand, 40187619 - 40187703
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| ||||||| |||||| ||||| |||||||| ||||||||||| |||||||| || |||||||||| |||||||| |||| |
|
|
| T |
40187619 |
ttttttggtggtgttcggggtttgaaccgcagaccttacatatattatg--cattgtccctaccaactgagttaagctcatgaggac |
40187703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 168 - 248
Target Start/End: Original strand, 20103436 - 20103514
Alignment:
| Q |
168 |
cttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||| |||||| ||||||||||||| | ||||||| | |||||||| ||||||||||| |||||||||| |||||| |
|
|
| T |
20103436 |
cttttttggtggtgtctggggttcgaaccccggaccttgtaaatattatg--cattgtccttaccaactgagttaagctca |
20103514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 31533393 - 31533446
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||||||| || ||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
31533393 |
gggttcgaaccccaaaccttgcatatattatgtatattgtccttatcaactgag |
31533446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 188 - 255
Target Start/End: Complemental strand, 38911358 - 38911293
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||||| ||| |||||||||||||||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
38911358 |
gttcgaacttcaaaccttgcatatattat--acattgtctttatcaactgagttaagctcacggggac |
38911293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 255
Target Start/End: Original strand, 41250038 - 41250114
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| |||| | ||||||| ||||||||||||||||| ||||||| ||||||||||||| | | ||||||||||| |
|
|
| T |
41250038 |
tggtgttcggggcttgaacctcggaccttgcatatattat--acattgttcttatcaactgagctaaactcatggggac |
41250114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 7872748 - 7872799
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
7872748 |
gggttcgaaccccagaccttgcatatattatg--cattgtccttaccaactgag |
7872799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 19793591 - 19793532
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactga |
238 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
19793591 |
tggtgtttggggttcgaaccccagaccttacatatattat--acattgtcctttccaactga |
19793532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 31723398 - 31723457
Alignment:
| Q |
180 |
tgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
31723398 |
tgtttgggtttcgaacctcagatcttgcatatattat--atattgttcttatcaactgagtt |
31723457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 248
Target Start/End: Complemental strand, 37235391 - 37235312
Alignment:
| Q |
167 |
acttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||| ||||| | ||||||| ||| ||||||||||||||||| ||| |||||||| |||||||||| || |||||| |
|
|
| T |
37235391 |
acttttttggtggtggtcggggttcaaacttcagaccttgcatatatcatg--cattgtccatatcaactgaattaagctca |
37235312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 168 - 248
Target Start/End: Complemental strand, 46987165 - 46987087
Alignment:
| Q |
168 |
cttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| | |||||| |||||||||||| | |||||||||||||||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
46987165 |
ctttttgggtggtgtccggggttcgaaccccggaccttgcatatattatg--cattgtccttaccaactgagctaagctca |
46987087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 248
Target Start/End: Original strand, 35142148 - 35142209
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||||||| || |||||||||||||| |||||||| ||||||||||| | |||||| |
|
|
| T |
35142148 |
ggggttcgaacctcaaactttgcatatattatg--cattgtccatatcaactgagctaagctca |
35142209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 239
Target Start/End: Complemental strand, 2618757 - 2618689
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| |||||| || | |||||||| | |||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
2618757 |
ttttttggtggtgtatgagattcgaaccccggaccttgcatatattatg--cattgtccttaccaactgag |
2618689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 185 - 255
Target Start/End: Complemental strand, 2916164 - 2916096
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||||||| | |||||||||||||||||||| |||||||| || |||||||||| || ||| |||||| |
|
|
| T |
2916164 |
ggggttcgaatcccagaccttgcatatattatg--cattgtccgtaccaactgagttaaggtcacggggac |
2916096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 219
Target Start/End: Original strand, 6768689 - 6768740
Alignment:
| Q |
168 |
cttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||| |||||| | | ||||||||||||||||||||||||||||||| |
|
|
| T |
6768689 |
cttttttgatggtgtccgagattcgaacctcagaccttgcatatattatgca |
6768740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 239
Target Start/End: Complemental strand, 10424039 - 10423971
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||| | |||||||||| ||||||| |
|
|
| T |
10424039 |
ttttttgttggtggccggggttcgaacctcagaccttatatatattatg--cgttgtccttatgaactgag |
10423971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 239
Target Start/End: Complemental strand, 18714526 - 18714458
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| |||||| |||||| ||||| | |||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
18714526 |
ttttttggtggtgtacggggtttgaaccccggaccttgcatatattatg--cattgtccttaccaactgag |
18714458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 219
Target Start/End: Complemental strand, 25923454 - 25923419
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25923454 |
tggggttcaaacctcagaccttgcatatattatgca |
25923419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 35165593 - 35165541
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
35165593 |
ggttcgaacctcagaccttacatatattatg--tattgtcgttatcaactgagtt |
35165541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 20085750 - 20085792
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
20085750 |
tggtgtttggggtttgaaccccggaccttgcatatattatgca |
20085792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 248
Target Start/End: Original strand, 21050223 - 21050282
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||| | |||||||||||||||||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
21050223 |
ggttcgaaacccagaccttgcatatattatg--cattgtccttaccaactgagctaagctca |
21050282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 1399232 - 1399170
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
||||| || ||||||||| |||||||||||||||||| ||| |||||||| || |||||||||| |
|
|
| T |
1399232 |
tggtggttagggttcgaatctcagaccttgcatatatcatg--cattgtccataccaactgagtt |
1399170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 241
Target Start/End: Original strand, 10236888 - 10236958
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||||||||| |||||| |||||| |||| |||||||||| |
|
|
| T |
10236888 |
ttttttggtggtgtccggggttcgaacctcgaaccttgcatacattatg--cattgttcttaccaactgagtt |
10236958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 23639482 - 23639527
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
23639482 |
ttttttggtggtgtctggggttcgaacccgagaccttgcatatatt |
23639527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 30296388 - 30296334
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| |||||||| | |||||| |
|
|
| T |
30296388 |
gaaccccagaccttgcatatattat--acattgtccttaccaactgagctaagctca |
30296334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 37230034 - 37230088
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||| |||||||||||||||||||| |||| |||||| |||||||||| |||||| |
|
|
| T |
37230034 |
gaaccccagaccttgcatatattatg--cattttccttaccaactgagttaagctca |
37230088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 37669336 - 37669381
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37669336 |
ttttttggtggtgtttggggttcgaacccaggaccttgcatatatt |
37669381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 43156198 - 43156153
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43156198 |
ttttttggtggtgtttggggttcgaacccgggaccttgcatatatt |
43156153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 48527237 - 48527191
Alignment:
| Q |
200 |
gaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
48527237 |
gaccttgcatatattatgca--ttgtccttatcaactgagataagctca |
48527191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 219
Target Start/End: Complemental strand, 3532649 - 3532609
Alignment:
| Q |
179 |
gtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||| |
|
|
| T |
3532649 |
gtgtttggggttcgaacctcggcccctgcatatattatgca |
3532609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 239
Target Start/End: Original strand, 3532995 - 3533059
Alignment:
| Q |
172 |
tttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||| |||||| ||||||||||||| || ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
3532995 |
tttggtggtgtatggggttcgaacc-cataccttgcatatattatg--cattgtccttactaactgag |
3533059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 5458062 - 5458131
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| | |||| ||| | |||||||||||||||||||| |||||| ||||||||||||| | |||||| |
|
|
| T |
5458062 |
tggtgttcgaggtttgaatcccagaccttgcatatattatg--cattgttcttatcaactgagctaagctca |
5458131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 5579755 - 5579694
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| ||||| || |||||||| | |||||| |
|
|
| T |
5579755 |
ggggtttgaaccccagaccttgcatatattatgcac--tgtccctaccaactgagctaagctca |
5579694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 239
Target Start/End: Original strand, 22777373 - 22777410
Alignment:
| Q |
200 |
gaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22777373 |
gaccttgcatatattatg--cattgtccttatcaactgag |
22777410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 217
Target Start/End: Original strand, 23069840 - 23069888
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
||||||| |||||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
23069840 |
ttttttggtggtgtccggggttcgaaccccataccttgcatatattatg |
23069888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 255
Target Start/End: Complemental strand, 27545004 - 27544951
Alignment:
| Q |
200 |
gaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| | |||||| |||||| |
|
|
| T |
27545004 |
gaccttgcatatattat--acattgtccttaccaactgagataagctcacggggac |
27544951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 248
Target Start/End: Complemental strand, 39801784 - 39801707
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| ||||| |||||||||| ||| | || ||||||||||||||| |||||||| || |||||||| | |||||| |
|
|
| T |
39801784 |
ttttttggtggtggttggggttcgtaccccggatcttgcatatattatg--cattgtccataccaactgagctaagctca |
39801707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 39926529 - 39926598
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||| |||| ||||| | || |||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
39926529 |
tggtgtttgaggtttgaaccccgaacattgcatatattatgca--ttgtccttatcaactgagctaagctca |
39926598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 41029330 - 41029273
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||| | ||||||||||||||||| |||||||||||| |||||||| | |||||| |
|
|
| T |
41029330 |
ttcgaaccccggaccttgcatatattat--acattgtccttaccaactgagctaagctca |
41029273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 248
Target Start/End: Original strand, 48007530 - 48007607
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||| |||||| ||| |||||||||||||||||||| ||||||| ||| |||||||||| |||||| |
|
|
| T |
48007530 |
ttttttggtggtgtcctgggttcaaactccagaccttgcatatattatg--cattgtcattaccaactgagttaagctca |
48007607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 57)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 169 - 248
Target Start/End: Original strand, 7371531 - 7371608
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||| |||||||||||| | |||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
7371531 |
ttttttgttggtgtccggggttcgaaccccggaccttgcatatattatg--tattgtccttatcaactgagttaagctca |
7371608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 169 - 255
Target Start/End: Original strand, 46676481 - 46676565
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| |||||| ||||| ||||||| | |||||||||||||||||| ||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
46676481 |
ttttttggtggtgtctgggggtcgaaccccggaccttgcatatattatg--cattgtccttaccaactgagctaagctcatggggac |
46676565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 17216120 - 17216189
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||| |||| | ||||||||||||| |||||||| |
|
|
| T |
17216120 |
tggtgtctggggttcgaacttcagaccttgcatatattatg--cattattcttatcaactgagcttagctca |
17216189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 19908754 - 19908693
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| |||||||||| |||||| |
|
|
| T |
19908754 |
ggggttcgaacctcggaccttgcatatattatg--cattgtccttaccaactgagttaagctca |
19908693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 169 - 255
Target Start/End: Complemental strand, 11269772 - 11269688
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| |||||| ||||||||||||| ||||||||||||||||||| |||||||||| ||||| |||| |||||| |||||| |
|
|
| T |
11269772 |
ttttttggtggtgtctggggttcgaacccaagaccttgcatatattatg--tattgtccttaccaactaagttaagctcacggggac |
11269688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 169 - 255
Target Start/End: Complemental strand, 18635608 - 18635524
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| ||||| |||| ||| |||| ||||||||| |||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
18635608 |
ttttttggcggtgtctgggattcaaaccccagaccttgtatatattatgca--ttgtccttatcaactgagttaagctcacggggac |
18635524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 248
Target Start/End: Original strand, 19124622 - 19124682
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
19124622 |
gggttcgaacctcagaccttgcatatattatg--tattgtctttatcaactgagttaagctca |
19124682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 185 - 254
Target Start/End: Original strand, 24785461 - 24785528
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatgggga |
254 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
24785461 |
ggggttcgaaccccagaccttgtatatattatg--cattgtccttaccaactgagcttagctcacgggga |
24785528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 185 - 254
Target Start/End: Complemental strand, 24822805 - 24822738
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatgggga |
254 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
24822805 |
ggggttcgaaccccagaccttgtatatattatg--cattgtccttaccaactgagcttagctcacgggga |
24822738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 169 - 219
Target Start/End: Original strand, 47806239 - 47806289
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
47806239 |
ttttttggtggtgttcggggttcgaaccccagaccttgcatatattatgca |
47806289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 169 - 257
Target Start/End: Original strand, 11144648 - 11144734
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacga |
257 |
Q |
| |
|
||||||| |||||| ||||||| |||| |||||||||||||||||||| ||||||| |||||||||||| | || ||||| |||||| |
|
|
| T |
11144648 |
ttttttggtggtgtccggggttcaaaccccagaccttgcatatattatg--cattgtctttatcaactgaggtaagttcatgaggacga |
11144734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 177 - 248
Target Start/End: Complemental strand, 38416127 - 38416058
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| |||| |||||| |||||||| | |||||| |
|
|
| T |
38416127 |
tggtgtttgggattcgaacctcataccttgcatatattatg--cattatccttaccaactgagctaagctca |
38416058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 185 - 248
Target Start/End: Original strand, 43034341 - 43034402
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||| || |||||||||| |||||| |
|
|
| T |
43034341 |
ggggtttgaacctcagaccttgcatatattatg--cattgtccataccaactgagttaagctca |
43034402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 238
Target Start/End: Complemental strand, 1701685 - 1701619
Alignment:
| Q |
171 |
ttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactga |
238 |
Q |
| |
|
||||| |||||| || |||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
1701685 |
ttttggtggtgtctgaggttcgaacctcggaccttgcatatattatgca-tttatccttatcaactga |
1701619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 255
Target Start/End: Complemental strand, 25978387 - 25978312
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||| |||| |||||||||| |||||||||||||||||| ||||||||||| |||||||| | |||||| |||||| |
|
|
| T |
25978387 |
tggtgtctgggattcgaacctcggaccttgcatatattatg--cattgtcctta-caactgagctaagctcacggggac |
25978312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 248
Target Start/End: Complemental strand, 44221508 - 44221448
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| || ||||||| || |||||| |
|
|
| T |
44221508 |
gggttcgaacctcagaccttgcatatattatg--cattgtccataccaactgaattaagctca |
44221448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 37800909 - 37800859
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||||| | |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
37800909 |
ttttttgttggtgatcggggttcgaaccccagacctcgcatatattatgca |
37800859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 49308881 - 49308830
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
49308881 |
gggttcgaaccccagaccttgcatatattatg--cattgtccttgtcaactgag |
49308830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 170 - 219
Target Start/End: Original strand, 22630344 - 22630393
Alignment:
| Q |
170 |
tttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| ||||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
22630344 |
tttttgatggtggtcggggtttgaacctcagaccttgcatatattatgca |
22630393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 236
Target Start/End: Complemental strand, 11166748 - 11166699
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaact |
236 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
11166748 |
ggggttcgaaccttagaccttgcatatattat--acattgtccttaccaact |
11166699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 219
Target Start/End: Original strand, 14542745 - 14542793
Alignment:
| Q |
171 |
ttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
14542745 |
ttttggtggtgttcagggttcgaaccccagaccttgcatatattatgca |
14542793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 29808269 - 29808318
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactga |
238 |
Q |
| |
|
|||||||||| || ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29808269 |
ggttcgaaccccataccttgcatatattatg--cattgtccttatcaactga |
29808318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 255
Target Start/End: Complemental strand, 29910516 - 29910455
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||| ||||| ||||||||||||||||| ||||||||||||| |||||| |||||| |||||| |
|
|
| T |
29910516 |
gaacttcagatcttgcatatattatgca--ttgtccttatcaattgagttaagctcacggggac |
29910455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 248
Target Start/End: Original strand, 42316827 - 42316884
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||| ||| |||||||||| |||||| |
|
|
| T |
42316827 |
ttcgaacctcggaccttgcatatattatgcac--tgtctttaccaactgagttaagctca |
42316884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 219
Target Start/End: Original strand, 3299088 - 3299127
Alignment:
| Q |
180 |
tgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
3299088 |
tgtttggggtttgaacctcaaaccttgcatatattatgca |
3299127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 185 - 255
Target Start/End: Complemental strand, 6474501 - 6474433
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||||||||| |||||||||| ||||| ||| |||||||||| ||||||||| | |||||| |||||| |
|
|
| T |
6474501 |
ggggttcgaaccccagaccttgcttatatgatg--cattgtccttgtcaactgagctaagctcacggggac |
6474433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 187 - 249
Target Start/End: Original strand, 20403169 - 20403229
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcat |
249 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| | ||||||||||| | ||||||| |
|
|
| T |
20403169 |
ggttcgaacttcagaccttgcatatattatg--cattgttcctatcaactgagctaagctcat |
20403229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 186 - 248
Target Start/End: Original strand, 35378187 - 35378247
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| | |||| ||||||||||||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
35378187 |
gggttcggatctcataccttgcatatatta--cacattgtccttatcaattgagttaagctca |
35378247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 189 - 255
Target Start/End: Original strand, 56497611 - 56497675
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||| ||| |||| | |||||| |||||| |
|
|
| T |
56497611 |
ttcgaaccccagaccttgcatatattatg--cattgtccttaccaattgagctaagctcacggggac |
56497675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 185 - 239
Target Start/End: Original strand, 56551591 - 56551643
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
56551591 |
ggggtttgaacctcggaccttgcatatattatg--cattgtccttaccaactgag |
56551643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 3580792 - 3580742
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||| |||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
3580792 |
ttttttggtggtgtccggggttcgaatcccagaccttgcatatattatgca |
3580742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 4911607 - 4911660
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||| ||||||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
4911607 |
gaacctcagaccttacatatattatgca---tatccttatcaactgagttaagctca |
4911660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Original strand, 22164252 - 22164302
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||||| | |||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
22164252 |
ttttttgttggtggtcggggtttgaaccccagaccttacatatattatgca |
22164302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 26004701 - 26004647
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaa |
234 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
26004701 |
tggtgtttggagttcgaatctca-accttgcatatattatgcac--tgtccttatcaa |
26004647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 29568656 - 29568614
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| ||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
29568656 |
tggtgtctggggttcgaacctcggaccttacatatattatgca |
29568614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Original strand, 33758787 - 33758837
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||| ||||| ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
33758787 |
ttttttggtggtggttgggatttaaacctcagaccttgcatatattatgca |
33758837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 219
Target Start/End: Original strand, 37930846 - 37930880
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
37930846 |
ggggtttgaacctcagaccttgcatatattatgca |
37930880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 241
Target Start/End: Original strand, 39842018 - 39842065
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||||| ||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
39842018 |
gaacctcaaaccttacatatattatgca--ttgtccttatcaactgagtt |
39842065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 47018358 - 47018309
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| || ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47018358 |
ttttttttttgtgtttggggttcgaacct-ggaccttgcatatattatgca |
47018309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 49473708 - 49473657
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactg |
237 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
49473708 |
tggggttcgaaccccggaccttgcatatattatg--cattgtccttaccaactg |
49473657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Original strand, 49716922 - 49716972
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| ||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
49716922 |
tttttttttggtgtccggggttagaacctcaaaccttgcatatattatgca |
49716972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Original strand, 50442731 - 50442780
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||| |||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
50442731 |
ttttttggtggtgtctgggattcgaacc-cagaccttgcatatattatgca |
50442780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 219
Target Start/End: Original strand, 52132301 - 52132335
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
52132301 |
ggggttcgaaccacagaccttgcatatattatgca |
52132335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 1166645 - 1166600
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
1166645 |
ttttttggtggtgtctggggttcgaacctgggaccttgcatatatt |
1166600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 1169127 - 1169082
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
1169127 |
ttttttggtggtgtctggggttcgaacctgggaccttgcatatatt |
1169082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 238
Target Start/End: Complemental strand, 16612698 - 16612650
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactga |
238 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
16612698 |
ttcgaacctcggaccttgcatatattctgca-tttgtccttatcaactga |
16612650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 29908103 - 29908057
Alignment:
| Q |
200 |
gaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
29908103 |
gaccttgcatatattatgca--ttgtccttaccaactgagttaagctca |
29908057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 30380588 - 30380538
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||||| || |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
30380588 |
ttcgaaccccaaaccttgcatatattat--acattgtccttaccaactgagtt |
30380538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 36203283 - 36203237
Alignment:
| Q |
200 |
gaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
36203283 |
gaccttgcatatattatgca--ttgtccttatcaactgagctaagctca |
36203237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 239
Target Start/End: Original strand, 43182994 - 43183044
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
43182994 |
ggttcaaaccttagaccttgcatatattatg--cattgtctttatcaactgag |
43183044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 187 - 219
Target Start/End: Complemental strand, 9990326 - 9990294
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
9990326 |
ggttcgaacctcagatcttgcatatattatgca |
9990294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 239
Target Start/End: Complemental strand, 12263307 - 12263262
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
12263307 |
gaacctcagaccttacatatattat--acattgtccttgtcaactgag |
12263262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 12698655 - 12698598
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |||||||||| | |||||| |
|
|
| T |
12698655 |
ttcgaaccccagaccttgcatatattatg--cattgtccaaatcaactgagctaagctca |
12698598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 217
Target Start/End: Original strand, 41222073 - 41222113
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||| |||| |
|
|
| T |
41222073 |
tggtgtctggggttcgaacctcggaccttgcatatactatg |
41222113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 239
Target Start/End: Original strand, 46434766 - 46434811
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
46434766 |
gaacctcaaaccttacatatattatg--cattgtccttatcaactgag |
46434811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 246
Target Start/End: Complemental strand, 56096272 - 56096207
Alignment:
| Q |
179 |
gtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagct |
246 |
Q |
| |
|
|||||||| ||| ||||| | ||||| ||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
56096272 |
gtgtttggagtttgaaccacgaaccttacatatattatgca--ttgtccttatcaactgagttaagct |
56096207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 56564974 - 56565043
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||| ||||| |||||||| |||||| |||| | |||||| |
|
|
| T |
56564974 |
tggtgttcggggttcgaaccctagaccttgcatattttatg--cattgtccatatcaattgagctaagctca |
56565043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 51)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 185 - 255
Target Start/End: Complemental strand, 24393307 - 24393239
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||| | |||||| |||||| |
|
|
| T |
24393307 |
ggggttcgaacctcagaccttgcatatattatg--cattgtccttaacaactgagctaagctcacggggac |
24393239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 185 - 255
Target Start/End: Complemental strand, 34903579 - 34903511
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||| | ||||||||||||| |
|
|
| T |
34903579 |
ggggttcgaacctcagaccttgcatatattatgcac--tgtccttaccaactgaactaagctcatggggac |
34903511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 187 - 248
Target Start/End: Original strand, 40967372 - 40967431
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||| |||||||| ||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
40967372 |
ggtttgaacctcaaaccttgcatatattatg--cattgtccttatcaactgagttaagctca |
40967431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 2257033 - 2256972
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| || |||||||||| |||||| |
|
|
| T |
2257033 |
ggggttcgaaccccagaccttgcatatattatg--cattgtccataccaactgagttaagctca |
2256972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 16204824 - 16204877
Alignment:
| Q |
193 |
aacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
16204824 |
aaccccagaccttgcatatattatgca--ttgtccttatcaactgagttaagctca |
16204877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 169 - 248
Target Start/End: Complemental strand, 24593454 - 24593377
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| ||||||| ||||||||||| | |||||||||||||||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
24593454 |
ttttttggtggtgttcagggttcgaaccccggaccttgcatatattatg--cattgtccttaccaactgagctaagctca |
24593377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 184 - 239
Target Start/End: Original strand, 43117188 - 43117241
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
43117188 |
tggggtttgaacctcagaccttgcatatattatg--cattgtccttaccaactgag |
43117241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 255
Target Start/End: Complemental strand, 7640728 - 7640652
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||| ||||||||||||||||| |||| ||||||||||| |||||||||| ||| |||||| |||||| |||||| |
|
|
| T |
7640728 |
tggtgtctggggttcgaacctcaggccttacatatattatg--tattgtccttaccaattgagttaagctcacggggac |
7640652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 239
Target Start/End: Complemental strand, 12124615 - 12124555
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
12124615 |
tggtgtttgaggttcgaaccccggaccttgcatatattatg--cattgtccttaccaactgag |
12124555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 185 - 235
Target Start/End: Complemental strand, 12413555 - 12413507
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaac |
235 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12413555 |
ggggtttgaacctcagaccttgcatatattatg--cattgtccttatcaac |
12413507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 185 - 235
Target Start/End: Complemental strand, 12425615 - 12425567
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaac |
235 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12425615 |
ggggtttgaacctcagaccttgcatatattatg--cattgtccttatcaac |
12425567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 255
Target Start/End: Original strand, 19179033 - 19179117
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| | ||||| ||| |||||| | |||||||||||||||||||| ||||||||||| |||||||| | |||||| |||||| |
|
|
| T |
19179033 |
ttttttggtagtgttcgggattcgaagcgcagaccttgcatatattatg--cattgtccttaccaactgagctaagctcacggggac |
19179117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 239
Target Start/End: Complemental strand, 28163997 - 28163937
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||||| |||| ||||||||||||||| ||||| ||||||| |||||||||||||||||||| |
|
|
| T |
28163997 |
tggtgtctgggattcgaacctcagaccgtgcatgtattatg--cattgtccttatcaactgag |
28163937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 189 - 255
Target Start/End: Original strand, 40099387 - 40099450
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||| |||||||| | ||||||||||||| |
|
|
| T |
40099387 |
ttcgaacctc-gaccttgcatatattatgca--ttgtccttaccaactgagctaagctcatggggac |
40099450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 169 - 241
Target Start/End: Complemental strand, 9982701 - 9982633
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||| ||||| ||||||||||||||| | |||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
9982701 |
tttttttttggtatttggggttcgaacc-cggacctt-catatattatgca--ttgtccttatcaactgagtt |
9982633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 188 - 256
Target Start/End: Complemental strand, 35727496 - 35727430
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacg |
256 |
Q |
| |
|
||||||||| || ||||||||||||||||| |||||| |||| |||||||||| |||||| ||||||| |
|
|
| T |
35727496 |
gttcgaaccccaaaccttgcatatattatg--cattgttcttaccaactgagttaagctcacggggacg |
35727430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 170 - 219
Target Start/End: Original strand, 43356526 - 43356575
Alignment:
| Q |
170 |
tttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||| || |||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
43356526 |
tttttttttgtgtttagggttcgaacctcggaccttgcatatattatgca |
43356575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 188 - 239
Target Start/End: Complemental strand, 5980286 - 5980237
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||||||| | ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5980286 |
gttcgaactttagaccttgcatatattatg--cattgtccttatcaactgag |
5980237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 9389533 - 9389476
Alignment:
| Q |
182 |
tttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
9389533 |
tttggggttcgaactccagaccttgcatatattat--acattatccttatcaattgagtt |
9389476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 169 - 248
Target Start/End: Complemental strand, 27152431 - 27152354
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||| ||||||||||| |||||||||||||||||||| |||| ||| || |||||||||| |||||| |
|
|
| T |
27152431 |
ttttttggtggtgtcctgggttcgaaccccagaccttgcatatattatg--cattatccctaccaactgagttaagctca |
27152354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 39068699 - 39068768
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| |||||||| |||| | || ||||||||||||||| |||||||||||||||||||| | |||||| |
|
|
| T |
39068699 |
tggtgtatggggttcaaaccccggatcttgcatatattatg--cattgtccttatcaactgagctaagctca |
39068768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 256
Target Start/End: Complemental strand, 39761499 - 39761431
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacg |
256 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| |||||||||||||||||||| | | |||| ||||||| |
|
|
| T |
39761499 |
ggggttcaaacc-cagaccttgcatatattatg--cattgtccttatcaactgagctaaactcacggggacg |
39761431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 239
Target Start/End: Complemental strand, 12124754 - 12124694
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
12124754 |
tggtgtttgaggttcgaactccggaccttgcatatattatg--cattgtccttaccaactgag |
12124694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 25274820 - 25274880
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| |||||||||||| |||||||| ||||||||||| |||||| |||| |||||||| |
|
|
| T |
25274820 |
tggtgttcggggttcgaaccccagaccttacatatattatg--cattgttcttaccaactgag |
25274880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 239
Target Start/End: Complemental strand, 28771660 - 28771592
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| |||||| |||||||||||| | || ||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
28771660 |
ttttttggtggtgtccggggttcgaaccgcggatcttgcatatattatg--cattgtccttaccaactgag |
28771592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 3503044 - 3503002
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
3503044 |
tggtgttcagggttcgaatctcagaccttgcatatattatgca |
3503002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 246
Target Start/End: Original strand, 9547408 - 9547467
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagct |
246 |
Q |
| |
|
|||||| ||||| || ||||||||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
9547408 |
ggggtttgaaccccaaaccttgcatatattatg--cattgtccatatcaactgagttaagct |
9547467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 219
Target Start/End: Complemental strand, 10724001 - 10723967
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
10724001 |
ggggtttgaacctcagaccttgcatatattatgca |
10723967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 217
Target Start/End: Original strand, 19156149 - 19156195
Alignment:
| Q |
171 |
ttttgttggtgtttggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
||||| |||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
19156149 |
ttttggtggtgtctggggtttgaacctcaaaccttgcatatattatg |
19156195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 248
Target Start/End: Original strand, 37320518 - 37320577
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||| ||| |||||||||| |||||| |
|
|
| T |
37320518 |
ggttcgaacctcgaaccttgcatatattatg--cattgtctttaccaactgagttaagctca |
37320577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 219
Target Start/End: Original strand, 42475109 - 42475143
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42475109 |
ggggttcgaacctcagaccttgcatattttatgca |
42475143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 10332281 - 10332335
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
10332281 |
gaacctccgaccttccatatattatgca--ttgtccttatcaactgagctaagctca |
10332335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 255
Target Start/End: Complemental strand, 19549496 - 19549430
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| | || || ||||||| |||||||| |||| |
|
|
| T |
19549496 |
ggttcgaatctcagaccttgcatatattatg--cattgttcataccagctgagttaagctcatgaggac |
19549430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 214
Target Start/End: Original strand, 25048837 - 25048866
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25048837 |
ggggttcgaacctcagaccttgcatatatt |
25048866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 220
Target Start/End: Complemental strand, 35757434 - 35757401
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcac |
220 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
35757434 |
ggttcgaacctcagactttgcatatattatgcac |
35757401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 2661031 - 2661067
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatat |
213 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
2661031 |
tggtggttggggttcgaacctcggaccttgcatatat |
2661067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 4897589 - 4897544
Alignment:
| Q |
201 |
accttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
4897589 |
accttgcatatattatgca--ttgtccttaccaactgagttaagctca |
4897544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 4944983 - 4944938
Alignment:
| Q |
201 |
accttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
4944983 |
accttgcatatattatgca--ttgtccttaccaactgagttaagctca |
4944938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 184 - 239
Target Start/End: Original strand, 7302140 - 7302192
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
7302140 |
tggggttcgaacc-cagaccttgcatattttatg--cattgtccctatcaactgag |
7302192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 217
Target Start/End: Complemental strand, 8920558 - 8920518
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
8920558 |
tggtgtttggaattcgaacctcaaaccttgcatatattatg |
8920518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 236
Target Start/End: Original strand, 11810381 - 11810430
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaact |
236 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
11810381 |
ggggttcgaaccccagactttgcacatattatg--cattgtccttatcaact |
11810430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 217
Target Start/End: Original strand, 12599864 - 12599896
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
12599864 |
ggggttcgaaccccagaccttgcatatattatg |
12599896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 18324885 - 18324954
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| ||||||||| | ||| ||||||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
18324885 |
tggtgttcagggttcgaatcctagatcttgcatatattatgca--ttgtccttaccaactgagttaagctca |
18324954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 20239401 - 20239344
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||| ||| |||||| |||||| |||||| |
|
|
| T |
20239401 |
ttcgaaccttagaccttgcatatattatg--cattatccctatcaattgagttaagctca |
20239344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 20565066 - 20565135
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||| |||||||| ||||| | |||||||||||||||||| |||||||| || |||||||| | |||||| |
|
|
| T |
20565066 |
tggtggttggggtttgaaccccggaccttgcatatattatg--cattgtccctaccaactgagctaagctca |
20565135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 184 - 239
Target Start/End: Original strand, 25186240 - 25186293
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| ||||| | |||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
25186240 |
tggggtttgaaccccggaccttgcatatattatg--cattgtccatatcaactgag |
25186293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 26133535 - 26133580
Alignment:
| Q |
201 |
accttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
26133535 |
accttgcatatattatgca--ttgtccttaccaactgagttaagctca |
26133580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 248
Target Start/End: Complemental strand, 28202375 - 28202298
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| || ||| |||||||| |||| || |||||| ||||||||||| |||||||| ||||||||||| | |||||| |
|
|
| T |
28202375 |
ttttttttttgtgattggggtttgaacttcggaccttacatatattatg--cattgtccctatcaactgagctaagctca |
28202298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 248
Target Start/End: Original strand, 31815886 - 31815947
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| ||||| | |||||||||||||||||| |||||||| || |||||||||| |||||| |
|
|
| T |
31815886 |
ggggtttgaaccccggaccttgcatatattatg--cattgtccctaccaactgagttaagctca |
31815947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 168 - 247
Target Start/End: Complemental strand, 32844941 - 32844865
Alignment:
| Q |
168 |
cttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctc |
247 |
Q |
| |
|
||||||||| ||||| ||||||||||||| |||||| ||||||||||| |||| || |||||||||||||| ||||| |
|
|
| T |
32844941 |
cttttttgt-ggtgtctggggttcgaaccgtggaccttacatatattatg--cattatcattatcaactgagttaagctc |
32844865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 239
Target Start/End: Original strand, 35685063 - 35685112
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
35685063 |
gttcgaaccctagaccttgcatatattatg--cattgtccttaccaactgag |
35685112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 169 - 254
Target Start/End: Complemental strand, 25467 - 25384
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatgggga |
254 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||||||||||||| ||||||||||| |||||||||| |||||| ||||| |
|
|
| T |
25467 |
ttttttggtggtgtctggggttcgaaccctggaccttgcatatattatg--cattgtccttaccaactgagttaagctcacgggga |
25384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 22)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 169 - 248
Target Start/End: Complemental strand, 30623371 - 30623294
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| | ||||| |||||||||||| |||||||||||||||||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
30623371 |
ttttttggtcgtgttcggggttcgaaccccagaccttgcatatattatg--cattgtccttaccaactgagctaagctca |
30623294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 250
Target Start/End: Original strand, 9655989 - 9656059
Alignment:
| Q |
178 |
ggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatg |
250 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| ||||| ||||||||||| |||||||| | |||||||| |
|
|
| T |
9655989 |
ggtggttggggttcgaacctcggaccttgcatattttatg--cattgtccttaccaactgagctaagctcatg |
9656059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 247
Target Start/End: Original strand, 8442493 - 8442546
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctc |
247 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||| ||||| |
|
|
| T |
8442493 |
gaacctcagaccttgcatatattatg--cattgtccttaccaactgagttaagctc |
8442546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 255
Target Start/End: Original strand, 9019555 - 9019631
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| ||||||| ||| |||||| ||| ||||||| ||||| |
|
|
| T |
9019555 |
tggtgtttggggttcaaacccaagaccttgcatatattatg--cattgtctttaccaactgcgttaagctcatcgggac |
9019631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 255
Target Start/End: Complemental strand, 19778143 - 19778059
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| |||||| | || |||||||| | |||||||||||||||||| ||||||||||| |||||||| | |||||| |||||| |
|
|
| T |
19778143 |
ttttttggtggtgtctaggattcgaaccccggaccttgcatatattatg--cattgtccttaccaactgagctaagctcacggggac |
19778059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 41430763 - 41430822
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactga |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| ||||||| |||||||||||| |
|
|
| T |
41430763 |
tggtgtttggggttcgaacctcagatattgtatatattat--acattgttcttatcaactga |
41430822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 183 - 255
Target Start/End: Original strand, 8984491 - 8984561
Alignment:
| Q |
183 |
ttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||| ||||| ||| || |||||||||| ||||||||||||| |
|
|
| T |
8984491 |
ttgggattcgaacatcaaaccttgcatatattat--acattatccataccaactgagttaagctcatggggac |
8984561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 185 - 239
Target Start/End: Original strand, 1244704 - 1244756
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||| |||||||| |
|
|
| T |
1244704 |
ggggttcgaaccccagaccttgtatatattatg--cattgtccttaccaactgag |
1244756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 217
Target Start/End: Original strand, 13032363 - 13032393
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13032363 |
ggttcgaacctcagaccttgcatatattatg |
13032393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 248
Target Start/End: Complemental strand, 24033329 - 24033257
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgca--cattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||| | ||||||||||| ||||| |||| |||||| |
|
|
| T |
24033329 |
tggtgattggggttcgaacc-cagaccttgcatatattatatatgcattgtccttaccaactaagttaagctca |
24033257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 248
Target Start/End: Original strand, 27750905 - 27750964
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| |||||||| |||||||| | |||||| |
|
|
| T |
27750905 |
ggttcgaaccccggaccttgcatatattatgcac--tgtccttaccaactgagctaagctca |
27750964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 29499849 - 29499799
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
29499849 |
ttttttggtggtgtttggggttcgaaccctggaccttgcatattttatgca |
29499799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 41625272 - 41625222
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| |||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
41625272 |
tttttttttggtggttggggttcgaaccctagaccttacatatattatgca |
41625222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 248
Target Start/End: Original strand, 42200663 - 42200722
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||| |||||||||||| |||||||||||| ||||||||| ||||||||||| | |||||| |
|
|
| T |
42200663 |
ggtttgaacctcagaccatgcatatattat--acattgtccctatcaactgagctaagctca |
42200722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 29186557 - 29186503
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||||||||| |||||||||| |||||| |
|
|
| T |
29186557 |
gaacctcataccttgcatatattacgca--ttgtccttaccaactgagttgagctca |
29186503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 32944839 - 32944893
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||| |||||||| || |||||||||| |
|
|
| T |
32944839 |
ggggtttgaacctcagaccttgcatattttatg--cattgtccataccaactgagtt |
32944893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 219
Target Start/End: Original strand, 38763515 - 38763548
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
38763515 |
gggttcgaaccccagaccttgcatatattatgca |
38763548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 239
Target Start/End: Original strand, 42208470 - 42208520
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
42208470 |
ggtttgaacctcggaccttgcatatattatg--cattgtccttaccaactgag |
42208520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 248
Target Start/End: Original strand, 6314322 - 6314383
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||| || |||||||||||| ||||||| |||||||||||||||||| | |||||| |
|
|
| T |
6314322 |
ggggttcgaatttcggaccttgcatattttatgca--ttgtccttatcaactgagctaagctca |
6314383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 239
Target Start/End: Complemental strand, 9071017 - 9070968
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||||||| |||||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
9071017 |
gttcgaacctcggaccttacatatattat--acattgtccttaccaactgag |
9070968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 170 - 214
Target Start/End: Original strand, 10290803 - 10290847
Alignment:
| Q |
170 |
tttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
10290803 |
tttttgatggtgtttggaattcgaacctcagaccctgcatatatt |
10290847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 32944987 - 32944942
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatc |
232 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32944987 |
ggggtttgaacttcagaccttgcatatattatg--cattgtccttatc |
32944942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 48)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 185 - 248
Target Start/End: Original strand, 28039859 - 28039920
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||| |||||||||| |||||| |
|
|
| T |
28039859 |
ggggttcaaacctcagaccttgcatatattatg--cattgtccttaccaactgagttaagctca |
28039920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 172 - 219
Target Start/End: Complemental strand, 22335433 - 22335386
Alignment:
| Q |
172 |
tttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
22335433 |
tttgttggtgttcggggtttgaacctcagaccttgcatatattatgca |
22335386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 169 - 255
Target Start/End: Original strand, 47528430 - 47528514
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||||||| ||||||||| ||||||||||| |||||||| | |||||| |||||| |
|
|
| T |
47528430 |
ttttttggtggtgtccggggttcgaacctcggaccttgcgtatattatg--cattgtccttaccaactgagctaagctcacggggac |
47528514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 170 - 255
Target Start/End: Original strand, 16580783 - 16580866
Alignment:
| Q |
170 |
tttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||| |||||| ||||| |||||||| ||||||||||||||||||| ||||||||| || ||||||| || |||||| |||||| |
|
|
| T |
16580783 |
ttttttttggtggttgggattcgaaccccagaccttgcatatattat--acattgtccataccaactgaattaagctcacggggac |
16580866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 185 - 256
Target Start/End: Original strand, 18056715 - 18056784
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacg |
256 |
Q |
| |
|
||||||||||||||| || |||||||||||||| ||||||||||| |||||||||| |||| | ||||||| |
|
|
| T |
18056715 |
ggggttcgaacctcacacattgcatatattatg--cattgtccttaccaactgagttaagcttacggggacg |
18056784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 255
Target Start/End: Original strand, 23405341 - 23405425
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| ||||| | ||| |||||||| |||||||||||||||||||| ||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
23405341 |
ttttttggtggtggtcgggattcgaaccctggaccttgcatatattatgca--ttgtccttaacaactaagttaagctcatggggac |
23405425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 41950067 - 41950114
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattat |
216 |
Q |
| |
|
||||||| ||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
41950067 |
ttttttggtggtggtcggggttcgaacctcagaccttgcatatattat |
41950114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 186 - 219
Target Start/End: Complemental strand, 29251815 - 29251782
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29251815 |
gggttcgaacctcagaccttgcatatattatgca |
29251782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 29987103 - 29987165
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
29987103 |
tggtggttggggttcgaactccagaccttgcatatattatg--cattgtccttgccaactgagtt |
29987165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 188 - 236
Target Start/End: Complemental strand, 30937534 - 30937488
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaact |
236 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30937534 |
gttcgaaccccagaccttgcatatattat--acattgtccttatcaact |
30937488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 172 - 256
Target Start/End: Original strand, 38448852 - 38448934
Alignment:
| Q |
172 |
tttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacg |
256 |
Q |
| |
|
|||| |||||| ||| |||||||| | |||||||||||||||||| ||||||||||| |||||||| | |||||| ||||||| |
|
|
| T |
38448852 |
tttggtggtgtccgggattcgaaccccggaccttgcatatattatg--cattgtccttaccaactgagctaagctcacggggacg |
38448934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 10132445 - 10132494
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactga |
238 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
10132445 |
ggttcgaaccccagaccttgcatatattatg--cattgtccttaccaactga |
10132494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 248
Target Start/End: Original strand, 15382822 - 15382879
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| | ||||||||||||| |||||| |
|
|
| T |
15382822 |
ttcgaacctcggaccttgcatatattat--acattgttcatatcaactgagttaagctca |
15382879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 169 - 248
Target Start/End: Original strand, 19262890 - 19262967
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||| ||||||||||||| | || |||||||| ||||| |||||||||||||||||||| | |||||| |
|
|
| T |
19262890 |
ttttttggtggtgtctggggttcgaaccccgaactttgcatatgttatg--cattgtccttatcaactgagctaagctca |
19262967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 33153871 - 33153940
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||| ||||||| |||||| ||||||||||| |||||||| || |||||||||| |||||| |
|
|
| T |
33153871 |
tggtgttcggggtttgaacctcggaccttacatatattatg--cattgtccctaccaactgagttaagctca |
33153940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 2665293 - 2665336
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcata-tattatgca |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2665293 |
tggtggttggggttcgaacctcagaccttgcatattattatgca |
2665336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 239
Target Start/End: Original strand, 3937520 - 3937575
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| ||||| | |||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
3937520 |
tggggtttgaaccccggaccttgcatatattatgtgcattgtccttaacaactgag |
3937575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 187 - 240
Target Start/End: Complemental strand, 5033603 - 5033551
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgt-ccttatcaactgagt |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
5033603 |
ggttcgaaccccagaccttgcatatattatgcac--tgtcccttatcaactgagt |
5033551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 185 - 220
Target Start/End: Complemental strand, 5280693 - 5280658
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcac |
220 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5280693 |
ggggttcgaaccccagaccttgcatatattatgcac |
5280658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 185 - 255
Target Start/End: Original strand, 6000142 - 6000210
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||| ||||||||| | |||||||||| | |||| |||||| |
|
|
| T |
6000142 |
ggggtttgaacctcggaccttgcatatattatg--cattgtcctaaccaactgagttaaactcacggggac |
6000210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 170 - 248
Target Start/End: Original strand, 9398397 - 9398473
Alignment:
| Q |
170 |
tttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| || ||| ||||||||||||| |||||||| ||||||| ||| |||||| |||| |||||||||||| |||| |
|
|
| T |
9398397 |
tttttggtgttgtctggggttcgaaccccagaccttacatatatcatg--cattgttcttaccaactgagtttatctca |
9398473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 239
Target Start/End: Original strand, 9872088 - 9872156
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| || ||| ||||||||||||| || ||||||||||||||||| |||| |||||| |||||||| |
|
|
| T |
9872088 |
ttttttggtgctgtctggggttcgaaccgcaaaccttgcatatattatg--cattatccttaccaactgag |
9872156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 13615603 - 13615663
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
13615603 |
tggtgttcggggttcgaaccttggaccttgcatgtattatg--cattgtccttaccaactgag |
13615663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 185 - 255
Target Start/End: Original strand, 17221519 - 17221587
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||| |||| ||||| |||| | |||| |||||| |
|
|
| T |
17221519 |
ggggttcgaacctcggaccttgcatatattatg--cattgttcttaccaacttagttaaactcacggggac |
17221587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 239
Target Start/End: Complemental strand, 30795779 - 30795711
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||||||||||||||||| |||||| |||| |||||||| |
|
|
| T |
30795779 |
ttttttggtggtgtttaaggttcgaaccttggaccttgcatatattatg--cattgttcttaccaactgag |
30795711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 219
Target Start/End: Original strand, 33020041 - 33020076
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33020041 |
tggggtttgaacctcagaccttgcatatattatgca |
33020076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 259
Target Start/End: Original strand, 34366282 - 34366370
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacgatt |
259 |
Q |
| |
|
|||||| ||||||| |||||| ||||||||||||||||||| |||||||| |||| ||||||||||| | |||||| ||||||||| |
|
|
| T |
34366282 |
tttttttttggtgtccagggttcaaacctcagaccttgcatatgttatgcac--tgtctttatcaactgaactaagctcaaagggacgatt |
34366370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 246
Target Start/End: Complemental strand, 912386 - 912311
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagct |
246 |
Q |
| |
|
||||||| |||||| |||||||| ||||||||||||| ||||||||| |||||| | |||||||||| ||| |||| |
|
|
| T |
912386 |
ttttttgatggtgtctggggttcaaacctcagaccttatatatattat--acattgactttatcaactgtgttaagct |
912311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 29233965 - 29234007
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
29233965 |
tggtggttggggttcgaaccccagaccttgcatattttatgca |
29234007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 32944814 - 32944764
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||| ||||| | |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
32944814 |
ttttttggtggtggtcggggttcgaaccccagacgttgcatatattatgca |
32944764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 34766920 - 34766861
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||||||||| || |||||||||| |||||| |
|
|
| T |
34766920 |
ggttcgaaccccagaccttgcatgtattat--acattgtccataccaactgagttaagctca |
34766861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 35442915 - 35442856
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||| | || ||||||||||||||||| |
|
|
| T |
35442915 |
ggttcgaacctcggaccttgaatatattatg--cattgttcataccaactgagtttagctca |
35442856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 219
Target Start/End: Original strand, 35778200 - 35778234
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
35778200 |
ggggttcgaacctcagaccttgcatatattgtgca |
35778234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 256
Target Start/End: Complemental strand, 1408478 - 1408428
Alignment:
| Q |
204 |
ttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacg |
256 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |||| ||||||||| |
|
|
| T |
1408478 |
ttgcatatattatgca--ttgtccttaccaactgagttaagcttatggggacg |
1408428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 170 - 219
Target Start/End: Original strand, 3157701 - 3157750
Alignment:
| Q |
170 |
tttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| ||||| |||||||| |||||||| |||||| |||||||||||| |
|
|
| T |
3157701 |
tttttggtggtggttggggtttgaacctcaaaccttgtatatattatgca |
3157750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 255
Target Start/End: Original strand, 9639818 - 9639884
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||||| | |||||||||||||||||| ||||||||||| ||| |||||| |||||| |||||| |
|
|
| T |
9639818 |
ggttcgaactccggaccttgcatatattatg--cattgtccttaccaagtgagttaagctcacggggac |
9639884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 240
Target Start/End: Original strand, 16033456 - 16033502
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagt |
240 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
16033456 |
gaaccccagaccttgcatatattatg--cattgtccctatcaactgagt |
16033502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 28832177 - 28832231
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | || |||||||||| |||||| |
|
|
| T |
28832177 |
gaacctcagaccttgcatatattatg--cattgttcataccaactgagttaagctca |
28832231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 219
Target Start/End: Complemental strand, 30561784 - 30561751
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
30561784 |
gggttcgaaccttagaccttgcatatattatgca |
30561751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 256
Target Start/End: Complemental strand, 45481552 - 45481486
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggacg |
256 |
Q |
| |
|
||||||||| | |||||||||||||||||| ||||||||||| ||| ||| || |||||| ||||||| |
|
|
| T |
45481552 |
gttcgaaccccggaccttgcatatattatg--cattgtccttaccaaatgaattaagctcacggggacg |
45481486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 219
Target Start/End: Original strand, 46335059 - 46335092
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
46335059 |
gggtttgaacctcagaccttgcatatattatgca |
46335092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 49875613 - 49875659
Alignment:
| Q |
200 |
gaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
49875613 |
gaccttgcatatattatgca--ttgtccttaccaactgagttaagctca |
49875659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 187 - 219
Target Start/End: Complemental strand, 13054933 - 13054901
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
13054933 |
ggttcgaacctccgaccttgcatatattatgca |
13054901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 248
Target Start/End: Complemental strand, 17034857 - 17034780
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||||| |||||||| ||||||||| || || ||| |||||||| ||||| || |||||||||||||| |||||| |
|
|
| T |
17034857 |
ttttttgttagtgtttggagttcgaaccccaaacgttgtttatattat--acattatctttatcaactgagttaagctca |
17034780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 176 - 239
Target Start/End: Original strand, 29798106 - 29798167
Alignment:
| Q |
176 |
ttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||| ||| ||||||||| |||||||| ||||||||||| |||||| |||||| |||||| |
|
|
| T |
29798106 |
ttggtgtctggtgttcgaaccccagaccttacatatattatg--cattgttcttatcgactgag |
29798167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 248
Target Start/End: Original strand, 34808566 - 34808623
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
34808566 |
ttcgaacctcgaaccttgcatatattatg--cattgtccttaacaactgagctaagctca |
34808623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 187 - 219
Target Start/End: Complemental strand, 41362679 - 41362647
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
41362679 |
ggttcgaacctccgaccttgcatatattatgca |
41362647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 239
Target Start/End: Complemental strand, 42416862 - 42416813
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||||||| || ||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
42416862 |
gttcgaaccccaaaccttgcatatattatg--cattatccttatcaactgag |
42416813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 29)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 170 - 248
Target Start/End: Complemental strand, 404240 - 404164
Alignment:
| Q |
170 |
tttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| |||||| ||||||||||||||| ||| |||||||||||||| ||||||||||| ||||| |||| |||||| |
|
|
| T |
404240 |
tttttggtggtgtctggggttcgaacctcggacattgcatatattatg--cattgtccttaccaactaagttaagctca |
404164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 12808947 - 12808897
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| || |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12808947 |
ttttttttttgtgtttggggttcgaaccccagaccttgcatatattatgca |
12808897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 35110132 - 35110082
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
35110132 |
ttttttggtggtgtttggggttcgaacctcaaaccttacatatattatgca |
35110082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 241
Target Start/End: Complemental strand, 10278528 - 10278461
Alignment:
| Q |
172 |
tttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||| ||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
10278528 |
tttggtggtggttggggttcgaacttcagatcttgcatatattatg--cattgtccatatcaattgagtt |
10278461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 28046170 - 28046228
Alignment:
| Q |
178 |
ggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactga |
238 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
28046170 |
ggtgttcggggttcaaacctcaaaccttgcatatattatg--cattgtctttatcaactga |
28046228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 186 - 246
Target Start/End: Complemental strand, 31971590 - 31971532
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagct |
246 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| ||||||||||| |||||||||| |||| |
|
|
| T |
31971590 |
gggtttgaacctcggaccttgcatatattatg--cattgtccttaccaactgagttaagct |
31971532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 248
Target Start/End: Original strand, 17829300 - 17829368
Alignment:
| Q |
178 |
ggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| |||||||||||||| ||| |||||||||||||| ||| ||||||| |||||||| | |||||| |
|
|
| T |
17829300 |
ggtgttcggggttcgaacctcggactttgcatatattatg--catagtccttaccaactgagctaagctca |
17829368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 241
Target Start/End: Complemental strand, 6610153 - 6610085
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| ||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
6610153 |
ttttttgttggtgtc--gggttcgaaccctagatcttgcatatattatg--cattgcccttatcaactgagtt |
6610085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 21865425 - 21865467
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
21865425 |
tggtgtctggggttctaaccttagaccttgcatatattatgca |
21865467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 219
Target Start/End: Original strand, 30639429 - 30639459
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30639429 |
ttcgaacctcagaccttgcatatattatgca |
30639459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 2726416 - 2726470
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| |||||||| || |||||||||| |
|
|
| T |
2726416 |
ggggttcgaaccccggaccttgcatatattatg--cattgtccataccaactgagtt |
2726470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 236
Target Start/End: Complemental strand, 3024632 - 3024575
Alignment:
| Q |
179 |
gtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaact |
236 |
Q |
| |
|
|||||| |||||||||| ||||| |||||||||||||| ||||| |||||| ||||| |
|
|
| T |
3024632 |
gtgtttagggttcgaacatcagatcttgcatatattatatacattatccttaccaact |
3024575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 203 - 251
Target Start/End: Original strand, 6864150 - 6864196
Alignment:
| Q |
203 |
cttgcatatattatgcacattgtccttatcaactgagtttagctcatgg |
251 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
6864150 |
cttgcatatattatgca--ttgtccttttcaactgagttaagctcatgg |
6864196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 14049890 - 14049944
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
14049890 |
gaacctcagaccttgcatatattatg--cattgtctcaatcaactgagcttagctca |
14049944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 248
Target Start/End: Original strand, 15291692 - 15291750
Alignment:
| Q |
188 |
gttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||| ||||| |||| |||||| |
|
|
| T |
15291692 |
gttcgaacctcaaaccttgcatatattat--tcattgtccttaccaactaagttaagctca |
15291750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 18256930 - 18256884
Alignment:
| Q |
200 |
gaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
18256930 |
gaccttgcatatattatgca--ttgtccttatcaactgagctaagctca |
18256884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 239
Target Start/End: Complemental strand, 33824941 - 33824891
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||| ||||| | |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33824941 |
ggtttgaaccccggaccttgcatatattatg--cattgtccttatcaactgag |
33824891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 239
Target Start/End: Complemental strand, 334195 - 334150
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
334195 |
gaaccccagaccttgcatatattatg--cattgtctttatcaactgag |
334150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 184 - 255
Target Start/End: Original strand, 3808116 - 3808185
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||| ||| ||| |||||||||||||||||| ||||||||||| ||||||||| || ||| |||||| |
|
|
| T |
3808116 |
tggggtttgaatctcggaccttgcatatattatg--cattgtccttactaactgagttaagttcacggggac |
3808185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 4450320 - 4450263
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||| |||||||||||| | |||||| |
|
|
| T |
4450320 |
ttcgaaccccggaccttgcatatattatg--cattgtctttatcaactgagctaagctca |
4450263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 186 - 256
Target Start/End: Complemental strand, 7273112 - 7273043
Alignment:
| Q |
186 |
gggttcgaacctcagaccttgcatatattatgcacattgt-ccttatcaactgagtttagctcatggggacg |
256 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| | ||||| |||||||||| |||||| ||||||| |
|
|
| T |
7273112 |
gggttcgaaccacagaccttgcatatattat--tcattatcccttaccaactgagttaagctcacggggacg |
7273043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 184 - 255
Target Start/End: Original strand, 8381192 - 8381261
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctcatggggac |
255 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| ||||||| ||| |||||||||| |||||| |||||| |
|
|
| T |
8381192 |
tggggttcgaaccctggaccttgcatatgttatg--cattgtctttaccaactgagttaagctcacggggac |
8381261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 239
Target Start/End: Original strand, 12232164 - 12232233
Alignment:
| Q |
169 |
ttttttgt-tggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||||||| ||||| | |||||||||||| ||||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
12232164 |
ttttttgtgtggtggtcggggttcgaaccccagacactgcatatattatg--cattgtccctatcaactgag |
12232233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 15187125 - 15187064
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||| |||||| ||||||| ||||| | |||||| |
|
|
| T |
15187125 |
ggggtttgaacctcggaccttgcatatattatg--cattgtacttatcagctgagctaagctca |
15187064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 248
Target Start/End: Original strand, 15473481 - 15473542
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||| |||||| ||||||| ||||| | |||||| |
|
|
| T |
15473481 |
ggggtttgaacctcggaccttgcatatattatg--cattgtacttatcagctgagctaagctca |
15473542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 20744200 - 20744139
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| |||||||| || |||||||| | |||||| |
|
|
| T |
20744200 |
ggggtttgaaccccagaccttgcatatattatg--cattgtccataccaactgagctaagctca |
20744139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 28757039 - 28757084
Alignment:
| Q |
201 |
accttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||| |||||| |
|
|
| T |
28757039 |
accttgcatatattat--acattgtccttaccaactgagttaagctca |
28757084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 219
Target Start/End: Original strand, 28758275 - 28758323
Alignment:
| Q |
171 |
ttttgttggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||| ||||||| |||||| ||||||| ||| |||||||||||||||| |
|
|
| T |
28758275 |
ttttggtggtgttcggggtttgaacctcggactttgcatatattatgca |
28758323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 29069545 - 29069484
Alignment:
| Q |
185 |
ggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| ||||||||||| || ||||||||||| |||||||| ||||||||||| | |||||| |
|
|
| T |
29069545 |
ggggtttgaacctcagacttttcatatattatg--cattgtccctatcaactgagctaagctca |
29069484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 5252 - 5210
Alignment:
| Q |
177 |
tggtgtttggggttcgaacctcagaccttgcatatattatgca |
219 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5252 |
tggtggttggggtttgaacctcagaccttgcatatattatgca |
5210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 248
Target Start/End: Original strand, 15928 - 15990
Alignment:
| Q |
184 |
tggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| |||||||||||| ||| |||||| |||||| |
|
|
| T |
15928 |
tggggtttgaaccccagaccttgcatatattat--acattgtccttaccaattgagttaagctca |
15990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0426 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0426
Description:
Target: scaffold0426; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 169 - 248
Target Start/End: Original strand, 5823 - 5900
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||| |||||||||| ||||| | ||| ||||||||| | |||||| |
|
|
| T |
5823 |
ttttttggtggtgtctggggttcgaaccccagaccttacatatattat--acattattcttttcaactgagctaagctca |
5900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 75383 - 75326
Alignment:
| Q |
189 |
ttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
75383 |
ttcgaaccccggaccttgcatatattatg--cattgtccttaccaactgagcttagctca |
75326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1694 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold1694
Description:
Target: scaffold1694; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 239
Target Start/End: Complemental strand, 215 - 165
Alignment:
| Q |
187 |
ggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgag |
239 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
215 |
ggtttgaacctcagaccttgcatacattatg--cattgtccatatcaactgag |
165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0481 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0481
Description:
Target: scaffold0481; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 4579 - 4624
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatatt |
214 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4579 |
ttttttggtggtgtttggggttcgaacccgggaccttgcatatatt |
4624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 34902 - 34948
Alignment:
| Q |
200 |
gaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
34902 |
gaccttgcatatattatgca--ttgtccttaccaactgagttaagctca |
34948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 240
Target Start/End: Complemental strand, 99092 - 99046
Alignment:
| Q |
192 |
gaacctcagaccttgcatatattatgcacattgtccttatcaactgagt |
240 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
99092 |
gaaccccagaccttgcatatattatg--cattgtccctatcaactgagt |
99046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1327 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold1327
Description:
Target: scaffold1327; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 248
Target Start/End: Complemental strand, 634 - 557
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtttagctca |
248 |
Q |
| |
|
|||||| |||||| | ||||||| | | ||||||||| |||||||||| ||| ||||||||||||||||| | |||||| |
|
|
| T |
634 |
tttttttttggtggtcggggttcaagcgtcagaccttacatatattatacac--tgtccttatcaactgagctaagctca |
557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0896 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0896
Description:
Target: scaffold0896; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 217
Target Start/End: Complemental strand, 3218 - 3171
Alignment:
| Q |
169 |
ttttttgttggtgtttggggttcgaacctcagaccttgcatatattatg |
217 |
Q |
| |
|
||||||||||||| || ||||| |||| ||||||||||||||||||||| |
|
|
| T |
3218 |
ttttttgttggtggttcgggtttgaac-tcagaccttgcatatattatg |
3171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 178 - 241
Target Start/End: Complemental strand, 48090 - 48029
Alignment:
| Q |
178 |
ggtgtttggggttcgaacctcagaccttgcatatattatgcacattgtccttatcaactgagtt |
241 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||||||||| |||| | ||||||||||||||| |
|
|
| T |
48090 |
ggtgtatggggttctaactccagaccttgcatatattatg--cattatgcttatcaactgagtt |
48029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University