View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16345_low_7 (Length: 326)

Name: NF16345_low_7
Description: NF16345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16345_low_7
NF16345_low_7
[»] chr1 (1 HSPs)
chr1 (45-326)||(23523087-23523371)


Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 45 - 326
Target Start/End: Original strand, 23523087 - 23523371
Alignment:
Q  45 ccttcttatccaacatggaacacaaactcaactaggttctataaccatccaacaacttcttcttactctcaacaacaacctatcaatggtagtcctttag 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23523087 ccttcttatccaacatggaacacaaactcaactaggttctataaccatccaacaacttcttcttactctcaacaacaacctatcaatggtagtcctttag 23523186  T
Q  145 ctttttggcgtatcccaaatggcacagttcagagtaaccctagtttcaaccatgaacgtcctttacctttgcttgcttctgaggaaagatcaaatttgtg 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23523187 ctttttggcgtatcccaaatggcacagttcagagtaaccctagtttcaaccatgaacgtcctttacctttgcttgcttctgaggaaagatcaaatttgtg 23523286  T
Q  245 gcatagtggacaaggagtac---cttcttcttctgcttcgcataatcgttacgtttatgactctaaacgtaacgaccatgttagt 326  Q
    ||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23523287 gcatagtggacaaggagtaccttcttcttcttctgcttcgcataatcgttacgtttatgactctaaacgtaacgaccatgttagt 23523371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University