View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16346_low_5 (Length: 213)
Name: NF16346_low_5
Description: NF16346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16346_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 12 - 156
Target Start/End: Original strand, 42677369 - 42677514
Alignment:
| Q |
12 |
atatactacatgttttcgtggtaccttcagaacatgttcacgccatgtttgttttttaagtgtttgtaccgattctattatgaaccacgctagccatcaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42677369 |
atatactacatgttttcgtggtaccttcagaacatgttcacgccatgtttgttttttaagtgtttgtaccgattctattgtgaaccacgctagccatcaa |
42677468 |
T |
|
| Q |
112 |
ttg-aaaatattgtaaggggaggttaattcatacagctttgtctaa |
156 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42677469 |
ttgaaaaatattgtaaggggaggttaattcatacagctttgtctaa |
42677514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 206
Target Start/End: Original strand, 42677520 - 42677553
Alignment:
| Q |
173 |
atgtgacggtgagttttgtttgtggtgatgatgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42677520 |
atgtgacggtgagttttgtttgtggtgatgatgt |
42677553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 206
Target Start/End: Complemental strand, 6705752 - 6705719
Alignment:
| Q |
173 |
atgtgacggtgagttttgtttgtggtgatgatgt |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
6705752 |
atgtggcggtgagttttgtttgtggtgatgatgt |
6705719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 206
Target Start/End: Complemental strand, 40900436 - 40900403
Alignment:
| Q |
173 |
atgtgacggtgagttttgtttgtggtgatgatgt |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
40900436 |
atgtggcggtgagttttgtttgtggtgatgatgt |
40900403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 206
Target Start/End: Complemental strand, 15496130 - 15496097
Alignment:
| Q |
173 |
atgtgacggtgagttttgtttgtggtgatgatgt |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
15496130 |
atgtggcggtgagttttgtttgtggtgatgatgt |
15496097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 51
Target Start/End: Complemental strand, 48968841 - 48968805
Alignment:
| Q |
15 |
tactacatgttttcgtggtaccttcagaacatgttca |
51 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
48968841 |
tactacaggtttttgtggtaccttcagaacatgttca |
48968805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University