View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16347_low_14 (Length: 238)
Name: NF16347_low_14
Description: NF16347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16347_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 35 - 219
Target Start/End: Original strand, 2907743 - 2907927
Alignment:
| Q |
35 |
ttattgatgtgtgtaagtacaaaatatccttttgataaatttaaatggattaattactatttagggttatacttaaaacttaaaagaaaaggaggtcaag |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2907743 |
ttattgatgtgtgtaagtacaaaatatccttttgataaatttaaatggattaattactatttaggggtatacttaaaacttaaaagaaaaggaggtcaag |
2907842 |
T |
 |
| Q |
135 |
atgttcatctcattcccctctctcctgggaatgagattgagatgtaaactctttttggtggaatctagcagtattatatacatcc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2907843 |
atgttcatctcattcccctctctcctgggaatgagattgagatgtaaactctttttggtggaatctagcagtgttatatacatcc |
2907927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University