View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16347_low_17 (Length: 212)
Name: NF16347_low_17
Description: NF16347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16347_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 48797428 - 48797252
Alignment:
| Q |
20 |
gagacttgagaataacgggttacctcgaagagagacaggaagagaagcagaggattgagcttgagcaagtgccatggttgatgaagtaagttattgtaac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48797428 |
gagacttgagaataacgggttacctcgaagagagacaggaagagaagcagagggttgagcttgagcaagtgccatggttgatgaagtaagttattgtaac |
48797329 |
T |
 |
| Q |
120 |
agtcaaattgcaatccttgttccttattatctctacctattcttttgagcaacggatgatgaaacatggccattcat |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48797328 |
agtcaaattgcaatccttattccttattatctctacctattcttttgagcaacggatgatgaaacatggccattcat |
48797252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University