View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16349_low_8 (Length: 246)
Name: NF16349_low_8
Description: NF16349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16349_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 8202857 - 8203094
Alignment:
| Q |
1 |
aatgtcatgttaaatttgcttgaattagacattgtaaattaattaagcagct----agcacttgttaagttgttatttaagctttaattagtttgtaatc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8202857 |
aatgtcatgttaaatttgcttgaattagacattgtaaattaattaagcagctagctagcacttgttaagttgttatttgagctttaattagtttgtaata |
8202956 |
T |
 |
| Q |
97 |
tcgtattaaaccaaaagttggttccaaactctccatctaggtagagaattagcaagctagcttatgatgttttatttgcaagaagtgtggtctgaaaaac |
196 |
Q |
| |
|
|| |||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8202957 |
tcacattaaacctaaagttggttccatactctccatctaggtagagaattagcaagctagcttatgatgttttatttgcaagaagtgtggtctgaaaaac |
8203056 |
T |
 |
| Q |
197 |
aaaatatgactgtattttattatctataagtttatatt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8203057 |
aaaatatgactgtattttattatctataagtttatatt |
8203094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University